Incidental Mutation 'R0940:Pkm'
ID81428
Institutional Source Beutler Lab
Gene Symbol Pkm
Ensembl Gene ENSMUSG00000032294
Gene Namepyruvate kinase, muscle
SynonymsPkm2, Pk-3, Pk-2, Pk3
MMRRC Submission 039079-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0940 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location59656368-59679375 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 59668535 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034834] [ENSMUST00000163694] [ENSMUST00000213930] [ENSMUST00000215623] [ENSMUST00000215660] [ENSMUST00000216620] [ENSMUST00000216857] [ENSMUST00000217038] [ENSMUST00000217353]
Predicted Effect probably benign
Transcript: ENSMUST00000034834
SMART Domains Protein: ENSMUSP00000034834
Gene: ENSMUSG00000032294

DomainStartEndE-ValueType
Pfam:PK 42 395 1.3e-172 PFAM
Pfam:PK_C 409 529 3.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163694
SMART Domains Protein: ENSMUSP00000128770
Gene: ENSMUSG00000032294

DomainStartEndE-ValueType
Pfam:PK 42 395 2.6e-174 PFAM
Pfam:PK_C 410 528 1.9e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213220
Predicted Effect probably benign
Transcript: ENSMUST00000213930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214571
Predicted Effect probably benign
Transcript: ENSMUST00000215623
Predicted Effect probably benign
Transcript: ENSMUST00000215660
Predicted Effect probably benign
Transcript: ENSMUST00000216620
Predicted Effect probably benign
Transcript: ENSMUST00000216857
Predicted Effect probably benign
Transcript: ENSMUST00000217038
Predicted Effect probably benign
Transcript: ENSMUST00000217353
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.0%
  • 20x: 96.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in glycolysis. The encoded protein is a pyruvate kinase that catalyzes the transfer of a phosphoryl group from phosphoenolpyruvate to ADP, generating ATP and pyruvate. This protein has been shown to interact with thyroid hormone and may mediate cellular metabolic effects induced by thyroid hormones. This protein has been found to bind Opa protein, a bacterial outer membrane protein involved in gonococcal adherence to and invasion of human cells, suggesting a role of this protein in bacterial pathogenesis. Several alternatively spliced transcript variants encoding a few distinct isoforms have been reported. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit prenatal lethality around the time of implanatation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik C T 9: 22,208,071 noncoding transcript Het
2610021A01Rik T G 7: 41,626,434 I520M probably damaging Het
Ackr4 A G 9: 104,099,632 F39L probably damaging Het
Adgre5 C T 8: 83,733,497 S92N probably damaging Het
Adrb2 T C 18: 62,179,691 D21G probably benign Het
AI464131 A G 4: 41,497,996 Y545H probably damaging Het
Akr1c6 G A 13: 4,436,373 E60K probably benign Het
Bcl7c T A 7: 127,707,331 N96I possibly damaging Het
Brca1 A T 11: 101,532,143 S106R possibly damaging Het
C6 A T 15: 4,735,235 T138S probably benign Het
Cul3 T C 1: 80,322,847 probably benign Het
Dnah8 T A 17: 30,803,243 M3939K probably damaging Het
Dock4 T A 12: 40,631,627 probably benign Het
Dsc2 T G 18: 20,050,059 T101P probably damaging Het
Dynlt1b T C 17: 6,430,250 probably benign Het
E330013P04Rik A G 19: 60,161,922 noncoding transcript Het
Fam160a1 A G 3: 85,665,490 V952A possibly damaging Het
Fggy A G 4: 95,697,001 E39G probably benign Het
Fmo6 A T 1: 162,926,226 C116S probably benign Het
Gadd45a A G 6: 67,036,829 I44T possibly damaging Het
Gmps A G 3: 63,976,322 probably benign Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Hnrnpm G A 17: 33,650,002 R523C probably damaging Het
Inpp5a T C 7: 139,525,738 Y202H probably damaging Het
Kank3 C T 17: 33,817,476 S106F probably damaging Het
Lmcd1 A G 6: 112,328,697 D253G probably benign Het
Lrrk2 A T 15: 91,729,081 I803F possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Mycbp2 A T 14: 103,262,693 probably benign Het
Myh4 A T 11: 67,242,863 N243Y probably damaging Het
Nfatc1 C T 18: 80,635,895 M759I probably benign Het
Nipal4 A G 11: 46,150,312 I352T possibly damaging Het
Nomo1 A G 7: 46,033,905 E25G possibly damaging Het
Olfr1221 T A 2: 89,112,075 I146L probably benign Het
Olfr128 A G 17: 37,923,700 I45V probably damaging Het
Olfr1408 A G 1: 173,130,453 S255P probably benign Het
Olfr392 T C 11: 73,814,224 N286S probably damaging Het
Olfr490 T C 7: 108,287,057 D23G probably benign Het
Olfr525 T C 7: 140,323,152 I151T probably benign Het
Pabpn1l A G 8: 122,622,444 V78A probably benign Het
Pde6b T A 5: 108,420,337 I327N possibly damaging Het
Phrf1 T C 7: 141,254,855 probably benign Het
Plxna2 G A 1: 194,800,555 V1519I probably benign Het
Ppp2cb T C 8: 33,615,661 probably null Het
Prickle2 A G 6: 92,411,003 Y473H probably benign Het
Prpf3 A G 3: 95,844,223 W389R probably damaging Het
Psme4 G A 11: 30,815,264 E544K possibly damaging Het
Relb A T 7: 19,611,842 D395E probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 A G 11: 119,416,563 N683S probably benign Het
Rtel1 T C 2: 181,322,803 C102R probably benign Het
Sel1l3 C T 5: 53,144,037 probably benign Het
Slc8a2 A G 7: 16,144,962 T458A probably benign Het
Smc3 T A 19: 53,640,909 M931K probably benign Het
Sorbs2 T C 8: 45,796,502 V795A probably benign Het
Tgm3 A G 2: 130,012,406 S2G probably benign Het
Tpbpa T C 13: 60,940,053 T75A probably damaging Het
Trub1 A G 19: 57,485,063 probably benign Het
Uggt2 A G 14: 119,091,192 probably null Het
Ugt2a3 A G 5: 87,327,206 V393A possibly damaging Het
Vav3 T A 3: 109,562,835 M532K possibly damaging Het
Zfp616 A T 11: 74,085,024 K706N probably damaging Het
Zkscan1 T C 5: 138,093,170 F55S probably damaging Het
Other mutations in Pkm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01693:Pkm APN 9 59670522 missense probably damaging 1.00
IGL02014:Pkm APN 9 59668961 missense possibly damaging 0.59
IGL02054:Pkm APN 9 59678201 missense probably damaging 1.00
negligible UTSW 9 59670634 missense probably damaging 1.00
R0087:Pkm UTSW 9 59678099 nonsense probably null
R0603:Pkm UTSW 9 59665881 missense probably damaging 0.97
R0990:Pkm UTSW 9 59678096 missense probably damaging 1.00
R1446:Pkm UTSW 9 59668910 splice site probably null
R5104:Pkm UTSW 9 59668681 critical splice donor site probably null
R5369:Pkm UTSW 9 59670634 missense probably damaging 1.00
R6831:Pkm UTSW 9 59675115 missense probably benign
R6974:Pkm UTSW 9 59668570 missense probably damaging 0.99
R7169:Pkm UTSW 9 59671625 missense possibly damaging 0.95
R7288:Pkm UTSW 9 59668913 missense probably benign 0.00
R7621:Pkm UTSW 9 59678158 nonsense probably null
R7844:Pkm UTSW 9 59670722 missense probably benign 0.00
R7927:Pkm UTSW 9 59670722 missense probably benign 0.00
R8217:Pkm UTSW 9 59678809 missense possibly damaging 0.74
R8234:Pkm UTSW 9 59670599 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TCGGCCATTGCTCACTAAGTCAAC -3'
(R):5'- AGATACTCACGCCCTTGATGAGTCC -3'

Sequencing Primer
(F):5'- TGCCAGGGCAGAAATCTTC -3'
(R):5'- CCTTGATGAGTCCAGTCCG -3'
Posted On2013-11-07