Incidental Mutation 'R0964:Zbtb41'
ID81438
Institutional Source Beutler Lab
Gene Symbol Zbtb41
Ensembl Gene ENSMUSG00000033964
Gene Namezinc finger and BTB domain containing 41
Synonyms9830132G07Rik, 8430415N23Rik
MMRRC Submission 039093-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R0964 (G1)
Quality Score138
Status Validated
Chromosome1
Chromosomal Location139422288-139453005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 139439031 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 583 (F583V)
Ref Sequence ENSEMBL: ENSMUSP00000045570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039867] [ENSMUST00000200243]
Predicted Effect probably damaging
Transcript: ENSMUST00000039867
AA Change: F583V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045570
Gene: ENSMUSG00000033964
AA Change: F583V

DomainStartEndE-ValueType
low complexity region 70 81 N/A INTRINSIC
BTB 89 183 7.06e-16 SMART
ZnF_C2H2 208 231 3.78e-1 SMART
low complexity region 234 245 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 301 327 N/A INTRINSIC
ZnF_C2H2 360 382 4.17e-3 SMART
ZnF_C2H2 388 410 8.34e-3 SMART
ZnF_C2H2 421 444 2.67e-1 SMART
ZnF_C2H2 462 484 1.72e-4 SMART
ZnF_C2H2 490 513 1.41e0 SMART
ZnF_C2H2 517 540 1.12e-3 SMART
ZnF_C2H2 546 568 1.36e-2 SMART
ZnF_C2H2 574 596 2.91e-2 SMART
ZnF_C2H2 602 624 7.37e-4 SMART
ZnF_C2H2 630 653 3.39e-3 SMART
ZnF_C2H2 667 689 2.75e-3 SMART
ZnF_C2H2 695 717 3.16e-3 SMART
ZnF_C2H2 723 746 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199011
Predicted Effect possibly damaging
Transcript: ENSMUST00000200243
AA Change: F583V

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142797
Gene: ENSMUSG00000033964
AA Change: F583V

DomainStartEndE-ValueType
low complexity region 70 81 N/A INTRINSIC
BTB 89 183 4.7e-18 SMART
ZnF_C2H2 208 231 1.6e-3 SMART
low complexity region 234 245 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 301 327 N/A INTRINSIC
ZnF_C2H2 360 382 1.7e-5 SMART
ZnF_C2H2 388 410 3.5e-5 SMART
ZnF_C2H2 421 444 1.1e-3 SMART
ZnF_C2H2 462 484 7.2e-7 SMART
ZnF_C2H2 490 513 5.9e-3 SMART
ZnF_C2H2 517 540 4.7e-6 SMART
ZnF_C2H2 546 568 5.7e-5 SMART
ZnF_C2H2 574 596 1.3e-4 SMART
ZnF_C2H2 602 624 3e-6 SMART
ZnF_C2H2 630 653 1.5e-5 SMART
Meta Mutation Damage Score 0.252 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Acacb A T 5: 114,229,752 M1604L possibly damaging Het
Acpp A G 9: 104,326,975 V40A possibly damaging Het
Adgrl1 T C 8: 83,934,412 probably benign Het
Alppl2 C T 1: 87,087,724 V372I possibly damaging Het
Apol8 C T 15: 77,749,611 S255N probably benign Het
Atp8b4 A T 2: 126,337,493 F973I probably damaging Het
Bbs4 A G 9: 59,322,976 *150Q probably null Het
Cacna1h A T 17: 25,378,775 probably benign Het
Ccser2 C T 14: 36,909,008 probably benign Het
Chd9 A G 8: 91,015,204 E1607G probably benign Het
Clca4b A G 3: 144,915,576 I579T probably benign Het
Col20a1 T A 2: 180,984,485 probably benign Het
Creg2 T C 1: 39,624,976 I205V probably benign Het
Cyr61 C A 3: 145,647,748 C353F probably damaging Het
Ddx24 C T 12: 103,423,907 R275H probably damaging Het
Dip2c G A 13: 9,568,663 A579T probably benign Het
Dnah3 T C 7: 119,952,739 probably benign Het
Dnah8 G A 17: 30,673,920 probably null Het
Gckr T C 5: 31,326,915 probably benign Het
Gpbp1l1 A G 4: 116,581,239 probably benign Het
Hmcn2 A G 2: 31,391,511 T1913A probably benign Het
Lmo7 T C 14: 101,920,567 probably benign Het
Meioc G A 11: 102,680,031 V863I probably damaging Het
Myh1 A G 11: 67,205,925 I341V probably benign Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Myh13 A G 11: 67,345,002 T664A probably benign Het
Myo3b A C 2: 70,426,849 D1269A probably damaging Het
Nckap1 A G 2: 80,547,899 probably null Het
Nr3c2 A G 8: 76,908,668 probably null Het
Nxpe5 T C 5: 138,239,924 S249P probably damaging Het
Olfr1008 A G 2: 85,690,365 N312S probably benign Het
Olfr460 T C 6: 40,572,205 V273A probably benign Het
Olfr67 C T 7: 103,787,397 M293I probably benign Het
Pitpnm3 G A 11: 72,058,470 T675I probably damaging Het
Plekhm1 C A 11: 103,395,082 E176* probably null Het
Prdm11 C A 2: 92,989,222 probably benign Het
Prodh2 C A 7: 30,506,281 R218S probably damaging Het
Rps15a T C 7: 118,114,837 D54G probably benign Het
Sbno2 G T 10: 80,084,259 T46N possibly damaging Het
Sdk2 A G 11: 113,806,417 probably benign Het
Sema3c T C 5: 17,721,909 F567L probably damaging Het
Slc36a1 A G 11: 55,225,954 probably benign Het
Spaca6 A T 17: 17,838,391 E284V possibly damaging Het
Srsf3 C A 17: 29,036,438 L66I probably damaging Het
Srsf3 T A 17: 29,036,439 L66Q probably damaging Het
Syne1 T C 10: 5,043,652 T8363A possibly damaging Het
Trmt1 T A 8: 84,696,852 L298Q probably damaging Het
Uba6 T C 5: 86,119,401 I923V possibly damaging Het
Uhrf1bp1 A T 17: 27,887,178 T893S probably damaging Het
Vmn2r106 G A 17: 20,267,597 H847Y probably benign Het
Vmn2r15 T C 5: 109,297,535 T8A probably benign Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Zfp938 T A 10: 82,225,419 I456F probably benign Het
Other mutations in Zbtb41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Zbtb41 APN 1 139430324 missense probably benign 0.01
IGL01796:Zbtb41 APN 1 139442883 missense probably damaging 0.99
IGL01844:Zbtb41 APN 1 139447327 missense probably benign 0.01
IGL02150:Zbtb41 APN 1 139440448 missense possibly damaging 0.73
IGL02346:Zbtb41 APN 1 139447100 missense probably damaging 1.00
IGL03139:Zbtb41 APN 1 139423838 missense probably benign 0.00
IGL03215:Zbtb41 APN 1 139446950 missense probably damaging 1.00
IGL03309:Zbtb41 APN 1 139432078 critical splice donor site probably null
memorialized UTSW 1 139440394 missense probably benign 0.00
Noted UTSW 1 139439031 missense probably damaging 0.99
unforgotten UTSW 1 139432078 critical splice donor site probably null
R0004:Zbtb41 UTSW 1 139442888 missense possibly damaging 0.90
R0010:Zbtb41 UTSW 1 139423530 missense probably damaging 1.00
R0010:Zbtb41 UTSW 1 139423530 missense probably damaging 1.00
R0048:Zbtb41 UTSW 1 139441834 missense probably damaging 1.00
R0230:Zbtb41 UTSW 1 139446935 missense probably damaging 1.00
R0309:Zbtb41 UTSW 1 139438984 missense probably damaging 0.99
R0458:Zbtb41 UTSW 1 139423476 missense probably damaging 1.00
R0606:Zbtb41 UTSW 1 139423610 missense probably benign 0.28
R1531:Zbtb41 UTSW 1 139423193 missense probably benign 0.00
R1723:Zbtb41 UTSW 1 139423563 missense probably benign 0.39
R1765:Zbtb41 UTSW 1 139440394 missense probably benign 0.00
R1829:Zbtb41 UTSW 1 139446922 nonsense probably null
R2077:Zbtb41 UTSW 1 139424093 missense probably damaging 1.00
R2292:Zbtb41 UTSW 1 139440359 missense probably damaging 0.99
R2380:Zbtb41 UTSW 1 139423814 missense probably damaging 0.99
R2402:Zbtb41 UTSW 1 139423185 missense probably benign 0.10
R2402:Zbtb41 UTSW 1 139423187 nonsense probably null
R3847:Zbtb41 UTSW 1 139423996 missense probably benign
R3848:Zbtb41 UTSW 1 139423996 missense probably benign
R3849:Zbtb41 UTSW 1 139423996 missense probably benign
R4077:Zbtb41 UTSW 1 139429326 missense probably benign 0.11
R4641:Zbtb41 UTSW 1 139442819 missense probably damaging 0.98
R4772:Zbtb41 UTSW 1 139447414 missense probably damaging 1.00
R5646:Zbtb41 UTSW 1 139423763 missense probably benign 0.05
R5754:Zbtb41 UTSW 1 139432078 critical splice donor site probably null
R6002:Zbtb41 UTSW 1 139423659 missense probably damaging 1.00
R6045:Zbtb41 UTSW 1 139424032 missense probably benign 0.34
R6302:Zbtb41 UTSW 1 139429289 missense possibly damaging 0.67
R6318:Zbtb41 UTSW 1 139430306 missense possibly damaging 0.91
R6430:Zbtb41 UTSW 1 139447207 missense probably benign 0.02
R6906:Zbtb41 UTSW 1 139423390 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- CAGCAGAAATCAGGAGCACTTCTCTC -3'
(R):5'- AGAACTCCAGAGCCCTTAATCTTAGCC -3'

Sequencing Primer
(F):5'- GAACTACAGGTTCTCTGGTCAAG -3'
(R):5'- AGAGCCCTTAATCTTAGCCTATTTTC -3'
Posted On2013-11-07