Incidental Mutation 'R0964:Col20a1'
ID81452
Institutional Source Beutler Lab
Gene Symbol Col20a1
Ensembl Gene ENSMUSG00000016356
Gene Namecollagen, type XX, alpha 1
Synonyms1700051I12Rik
MMRRC Submission 039093-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0964 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location180986535-181018363 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 180984485 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029092] [ENSMUST00000108856] [ENSMUST00000108859] [ENSMUST00000108860] [ENSMUST00000108861] [ENSMUST00000108862] [ENSMUST00000149179] [ENSMUST00000184394] [ENSMUST00000185115] [ENSMUST00000228434]
Predicted Effect probably benign
Transcript: ENSMUST00000029092
SMART Domains Protein: ENSMUSP00000029092
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 310 327 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
low complexity region 359 392 N/A INTRINSIC
low complexity region 394 401 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000094214
SMART Domains Protein: ENSMUSP00000091767
Gene: ENSMUSG00000070461

DomainStartEndE-ValueType
low complexity region 107 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108856
SMART Domains Protein: ENSMUSP00000104484
Gene: ENSMUSG00000016356

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 24 103 2.18e1 SMART
VWA 175 354 4.68e-55 SMART
FN3 375 453 6.2e-7 SMART
FN3 464 543 7.34e-9 SMART
FN3 555 633 8.18e-7 SMART
FN3 644 723 8.98e-4 SMART
FN3 738 817 1.43e-11 SMART
TSPN 840 1035 6.45e-31 SMART
Pfam:Collagen 1067 1125 3.8e-9 PFAM
Pfam:Collagen 1122 1174 7.4e-9 PFAM
Pfam:Collagen 1165 1223 3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108859
SMART Domains Protein: ENSMUSP00000104487
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 288 305 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
low complexity region 337 370 N/A INTRINSIC
low complexity region 372 379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108860
SMART Domains Protein: ENSMUSP00000104488
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 288 305 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
low complexity region 337 370 N/A INTRINSIC
low complexity region 372 379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108861
SMART Domains Protein: ENSMUSP00000104489
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 290 307 N/A INTRINSIC
low complexity region 314 327 N/A INTRINSIC
low complexity region 339 372 N/A INTRINSIC
low complexity region 374 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108862
SMART Domains Protein: ENSMUSP00000104490
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 290 307 N/A INTRINSIC
low complexity region 314 327 N/A INTRINSIC
low complexity region 339 372 N/A INTRINSIC
low complexity region 374 381 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148908
Predicted Effect probably benign
Transcript: ENSMUST00000149179
SMART Domains Protein: ENSMUSP00000115291
Gene: ENSMUSG00000016356

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 24 103 2.18e1 SMART
VWA 175 354 4.68e-55 SMART
FN3 375 453 6.2e-7 SMART
FN3 464 543 7.34e-9 SMART
FN3 555 633 8.18e-7 SMART
FN3 644 723 8.98e-4 SMART
FN3 738 817 1.43e-11 SMART
TSPN 840 1035 6.45e-31 SMART
low complexity region 1069 1106 N/A INTRINSIC
low complexity region 1108 1121 N/A INTRINSIC
low complexity region 1136 1155 N/A INTRINSIC
Blast:TSPN 1156 1202 2e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184394
SMART Domains Protein: ENSMUSP00000138843
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 298 315 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 347 380 N/A INTRINSIC
low complexity region 382 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185115
SMART Domains Protein: ENSMUSP00000139222
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 320 337 N/A INTRINSIC
low complexity region 344 357 N/A INTRINSIC
low complexity region 369 402 N/A INTRINSIC
low complexity region 404 411 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189441
Predicted Effect probably benign
Transcript: ENSMUST00000228434
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Acacb A T 5: 114,229,752 M1604L possibly damaging Het
Acpp A G 9: 104,326,975 V40A possibly damaging Het
Adgrl1 T C 8: 83,934,412 probably benign Het
Alppl2 C T 1: 87,087,724 V372I possibly damaging Het
Apol8 C T 15: 77,749,611 S255N probably benign Het
Atp8b4 A T 2: 126,337,493 F973I probably damaging Het
Bbs4 A G 9: 59,322,976 *150Q probably null Het
Cacna1h A T 17: 25,378,775 probably benign Het
Ccser2 C T 14: 36,909,008 probably benign Het
Chd9 A G 8: 91,015,204 E1607G probably benign Het
Clca4b A G 3: 144,915,576 I579T probably benign Het
Creg2 T C 1: 39,624,976 I205V probably benign Het
Cyr61 C A 3: 145,647,748 C353F probably damaging Het
Ddx24 C T 12: 103,423,907 R275H probably damaging Het
Dip2c G A 13: 9,568,663 A579T probably benign Het
Dnah3 T C 7: 119,952,739 probably benign Het
Dnah8 G A 17: 30,673,920 probably null Het
Gckr T C 5: 31,326,915 probably benign Het
Gpbp1l1 A G 4: 116,581,239 probably benign Het
Hmcn2 A G 2: 31,391,511 T1913A probably benign Het
Lmo7 T C 14: 101,920,567 probably benign Het
Meioc G A 11: 102,680,031 V863I probably damaging Het
Myh1 A G 11: 67,205,925 I341V probably benign Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Myh13 A G 11: 67,345,002 T664A probably benign Het
Myo3b A C 2: 70,426,849 D1269A probably damaging Het
Nckap1 A G 2: 80,547,899 probably null Het
Nr3c2 A G 8: 76,908,668 probably null Het
Nxpe5 T C 5: 138,239,924 S249P probably damaging Het
Olfr1008 A G 2: 85,690,365 N312S probably benign Het
Olfr460 T C 6: 40,572,205 V273A probably benign Het
Olfr67 C T 7: 103,787,397 M293I probably benign Het
Pitpnm3 G A 11: 72,058,470 T675I probably damaging Het
Plekhm1 C A 11: 103,395,082 E176* probably null Het
Prdm11 C A 2: 92,989,222 probably benign Het
Prodh2 C A 7: 30,506,281 R218S probably damaging Het
Rps15a T C 7: 118,114,837 D54G probably benign Het
Sbno2 G T 10: 80,084,259 T46N possibly damaging Het
Sdk2 A G 11: 113,806,417 probably benign Het
Sema3c T C 5: 17,721,909 F567L probably damaging Het
Slc36a1 A G 11: 55,225,954 probably benign Het
Spaca6 A T 17: 17,838,391 E284V possibly damaging Het
Srsf3 C A 17: 29,036,438 L66I probably damaging Het
Srsf3 T A 17: 29,036,439 L66Q probably damaging Het
Syne1 T C 10: 5,043,652 T8363A possibly damaging Het
Trmt1 T A 8: 84,696,852 L298Q probably damaging Het
Uba6 T C 5: 86,119,401 I923V possibly damaging Het
Uhrf1bp1 A T 17: 27,887,178 T893S probably damaging Het
Vmn2r106 G A 17: 20,267,597 H847Y probably benign Het
Vmn2r15 T C 5: 109,297,535 T8A probably benign Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Zbtb41 T G 1: 139,439,031 F583V probably damaging Het
Zfp938 T A 10: 82,225,419 I456F probably benign Het
Other mutations in Col20a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Col20a1 APN 2 181003479 missense possibly damaging 0.93
IGL00975:Col20a1 APN 2 180992478 missense probably damaging 1.00
IGL01094:Col20a1 APN 2 180999766 missense probably damaging 0.99
IGL01388:Col20a1 APN 2 181003471 missense probably benign 0.24
IGL01472:Col20a1 APN 2 181007832 missense probably benign 0.44
IGL01936:Col20a1 APN 2 181009368 splice site probably benign
IGL02133:Col20a1 APN 2 181007144 missense probably damaging 1.00
IGL02318:Col20a1 APN 2 181007159 missense probably damaging 0.99
IGL02576:Col20a1 APN 2 181013405 nonsense probably null
IGL02822:Col20a1 APN 2 180996807 missense probably damaging 1.00
IGL02898:Col20a1 APN 2 180989112 nonsense probably null
IGL03056:Col20a1 APN 2 180994889 missense probably damaging 1.00
IGL03189:Col20a1 APN 2 181009407 nonsense probably null
IGL03196:Col20a1 APN 2 181007878 splice site probably null
R0001:Col20a1 UTSW 2 180984412 unclassified probably benign
R0200:Col20a1 UTSW 2 181000438 missense probably damaging 1.00
R0384:Col20a1 UTSW 2 180999162 missense probably benign 0.00
R0975:Col20a1 UTSW 2 181006826 missense possibly damaging 0.75
R1359:Col20a1 UTSW 2 180999792 missense probably benign 0.02
R1395:Col20a1 UTSW 2 180998607 missense probably damaging 0.99
R1470:Col20a1 UTSW 2 180994960 missense probably benign 0.01
R1470:Col20a1 UTSW 2 180994960 missense probably benign 0.01
R1508:Col20a1 UTSW 2 180992577 missense probably damaging 0.98
R1865:Col20a1 UTSW 2 181015813 missense possibly damaging 0.87
R1883:Col20a1 UTSW 2 180992910 missense possibly damaging 0.52
R1884:Col20a1 UTSW 2 180992910 missense possibly damaging 0.52
R1906:Col20a1 UTSW 2 180998697 missense probably benign 0.00
R2020:Col20a1 UTSW 2 181013163 critical splice donor site probably null
R2121:Col20a1 UTSW 2 180996456 missense probably damaging 0.99
R2131:Col20a1 UTSW 2 180992573 missense probably damaging 1.00
R2343:Col20a1 UTSW 2 181001331 missense possibly damaging 0.73
R3153:Col20a1 UTSW 2 181008593 missense probably damaging 1.00
R3430:Col20a1 UTSW 2 181013285 nonsense probably null
R3547:Col20a1 UTSW 2 180994911 missense probably damaging 1.00
R3844:Col20a1 UTSW 2 180992449 missense probably damaging 1.00
R3914:Col20a1 UTSW 2 180998492 missense probably benign 0.00
R4414:Col20a1 UTSW 2 181001250 missense possibly damaging 0.92
R4711:Col20a1 UTSW 2 180992491 missense probably damaging 1.00
R4760:Col20a1 UTSW 2 180984403 unclassified probably benign
R4771:Col20a1 UTSW 2 180989124 missense probably benign 0.17
R4809:Col20a1 UTSW 2 180998661 missense probably damaging 1.00
R4872:Col20a1 UTSW 2 180997363 missense possibly damaging 0.74
R5045:Col20a1 UTSW 2 181006845 missense probably damaging 1.00
R5238:Col20a1 UTSW 2 180998586 missense probably damaging 1.00
R5566:Col20a1 UTSW 2 180986523 unclassified probably null
R6389:Col20a1 UTSW 2 180992583 splice site probably null
R6422:Col20a1 UTSW 2 181014819 missense possibly damaging 0.75
R6924:Col20a1 UTSW 2 180996850 missense probably damaging 1.00
R6982:Col20a1 UTSW 2 180996706 missense probably benign 0.00
R7177:Col20a1 UTSW 2 180994214 nonsense probably null
R7195:Col20a1 UTSW 2 181007231 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATTCCTGTGAGCTACGGCCAC -3'
(R):5'- TGAGAGCCTCTGACCAGCCTATTTG -3'

Sequencing Primer
(F):5'- TGAGCTACGGCCACAGATG -3'
(R):5'- TTTAGACTACCAATCACTAGGGGC -3'
Posted On2013-11-07