Incidental Mutation 'R0964:Gpbp1l1'
ID81458
Institutional Source Beutler Lab
Gene Symbol Gpbp1l1
Ensembl Gene ENSMUSG00000034042
Gene NameGC-rich promoter binding protein 1-like 1
Synonyms
MMRRC Submission 039093-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0964 (G1)
Quality Score171
Status Validated
Chromosome4
Chromosomal Location116557658-116593882 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 116581239 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030460] [ENSMUST00000106475]
Predicted Effect probably benign
Transcript: ENSMUST00000030460
SMART Domains Protein: ENSMUSP00000030460
Gene: ENSMUSG00000034042

DomainStartEndE-ValueType
low complexity region 204 219 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 289 320 N/A INTRINSIC
Pfam:Vasculin 376 470 5.1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106475
SMART Domains Protein: ENSMUSP00000102083
Gene: ENSMUSG00000034042

DomainStartEndE-ValueType
low complexity region 204 219 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 289 320 N/A INTRINSIC
Pfam:Vasculin 377 470 1.3e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138837
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Acacb A T 5: 114,229,752 M1604L possibly damaging Het
Acpp A G 9: 104,326,975 V40A possibly damaging Het
Adgrl1 T C 8: 83,934,412 probably benign Het
Alppl2 C T 1: 87,087,724 V372I possibly damaging Het
Apol8 C T 15: 77,749,611 S255N probably benign Het
Atp8b4 A T 2: 126,337,493 F973I probably damaging Het
Bbs4 A G 9: 59,322,976 *150Q probably null Het
Cacna1h A T 17: 25,378,775 probably benign Het
Ccser2 C T 14: 36,909,008 probably benign Het
Chd9 A G 8: 91,015,204 E1607G probably benign Het
Clca4b A G 3: 144,915,576 I579T probably benign Het
Col20a1 T A 2: 180,984,485 probably benign Het
Creg2 T C 1: 39,624,976 I205V probably benign Het
Cyr61 C A 3: 145,647,748 C353F probably damaging Het
Ddx24 C T 12: 103,423,907 R275H probably damaging Het
Dip2c G A 13: 9,568,663 A579T probably benign Het
Dnah3 T C 7: 119,952,739 probably benign Het
Dnah8 G A 17: 30,673,920 probably null Het
Gckr T C 5: 31,326,915 probably benign Het
Hmcn2 A G 2: 31,391,511 T1913A probably benign Het
Lmo7 T C 14: 101,920,567 probably benign Het
Meioc G A 11: 102,680,031 V863I probably damaging Het
Myh1 A G 11: 67,205,925 I341V probably benign Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Myh13 A G 11: 67,345,002 T664A probably benign Het
Myo3b A C 2: 70,426,849 D1269A probably damaging Het
Nckap1 A G 2: 80,547,899 probably null Het
Nr3c2 A G 8: 76,908,668 probably null Het
Nxpe5 T C 5: 138,239,924 S249P probably damaging Het
Olfr1008 A G 2: 85,690,365 N312S probably benign Het
Olfr460 T C 6: 40,572,205 V273A probably benign Het
Olfr67 C T 7: 103,787,397 M293I probably benign Het
Pitpnm3 G A 11: 72,058,470 T675I probably damaging Het
Plekhm1 C A 11: 103,395,082 E176* probably null Het
Prdm11 C A 2: 92,989,222 probably benign Het
Prodh2 C A 7: 30,506,281 R218S probably damaging Het
Rps15a T C 7: 118,114,837 D54G probably benign Het
Sbno2 G T 10: 80,084,259 T46N possibly damaging Het
Sdk2 A G 11: 113,806,417 probably benign Het
Sema3c T C 5: 17,721,909 F567L probably damaging Het
Slc36a1 A G 11: 55,225,954 probably benign Het
Spaca6 A T 17: 17,838,391 E284V possibly damaging Het
Srsf3 C A 17: 29,036,438 L66I probably damaging Het
Srsf3 T A 17: 29,036,439 L66Q probably damaging Het
Syne1 T C 10: 5,043,652 T8363A possibly damaging Het
Trmt1 T A 8: 84,696,852 L298Q probably damaging Het
Uba6 T C 5: 86,119,401 I923V possibly damaging Het
Uhrf1bp1 A T 17: 27,887,178 T893S probably damaging Het
Vmn2r106 G A 17: 20,267,597 H847Y probably benign Het
Vmn2r15 T C 5: 109,297,535 T8A probably benign Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Zbtb41 T G 1: 139,439,031 F583V probably damaging Het
Zfp938 T A 10: 82,225,419 I456F probably benign Het
Other mutations in Gpbp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Gpbp1l1 APN 4 116587513 critical splice donor site probably null
IGL03342:Gpbp1l1 APN 4 116574543 missense probably benign
R0534:Gpbp1l1 UTSW 4 116591268 missense probably damaging 1.00
R1136:Gpbp1l1 UTSW 4 116592918 missense probably damaging 1.00
R1169:Gpbp1l1 UTSW 4 116574366 missense possibly damaging 0.53
R3975:Gpbp1l1 UTSW 4 116570985 critical splice donor site probably null
R4296:Gpbp1l1 UTSW 4 116587459 missense possibly damaging 0.80
R4676:Gpbp1l1 UTSW 4 116590265 missense probably damaging 1.00
R4870:Gpbp1l1 UTSW 4 116573517 missense probably benign
R5086:Gpbp1l1 UTSW 4 116588592 missense probably benign 0.04
R5931:Gpbp1l1 UTSW 4 116590260 missense probably benign 0.00
R6486:Gpbp1l1 UTSW 4 116581375 missense probably damaging 0.99
R6604:Gpbp1l1 UTSW 4 116573505 missense probably benign 0.09
R6973:Gpbp1l1 UTSW 4 116581282 missense possibly damaging 0.53
R7031:Gpbp1l1 UTSW 4 116592848 missense probably damaging 1.00
R7230:Gpbp1l1 UTSW 4 116588610 missense probably damaging 0.99
R7286:Gpbp1l1 UTSW 4 116590245 missense probably benign 0.02
R7368:Gpbp1l1 UTSW 4 116573458 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GGGTTCTTAAGCTCATATACCCGTGC -3'
(R):5'- GCAACTCATACCTTAGAGGGAGGTGG -3'

Sequencing Primer
(F):5'- cgtgcttgcatggtaaacac -3'
(R):5'- CTTAGGCACCAAGTTCTTATAGACAC -3'
Posted On2013-11-07