Incidental Mutation 'R0964:Sema3c'
ID 81460
Institutional Source Beutler Lab
Gene Symbol Sema3c
Ensembl Gene ENSMUSG00000028780
Gene Name sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C
Synonyms Semae, 1110036B02Rik
MMRRC Submission 039093-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0964 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 17779814-17935266 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 17926907 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 567 (F567L)
Ref Sequence ENSEMBL: ENSMUSP00000030568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030568]
AlphaFold Q62181
Predicted Effect probably damaging
Transcript: ENSMUST00000030568
AA Change: F567L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030568
Gene: ENSMUSG00000028780
AA Change: F567L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Sema 54 495 1.16e-200 SMART
PSI 513 565 2.87e-13 SMART
IG 577 662 7.08e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115271
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutation exhibit perinatal lethality, hypopigmentation and abnormal heart development. Mice homozygous for a knock-out allele exhibit prenatal lethality associated with heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,642,480 (GRCm39) T141S probably benign Het
Acacb A T 5: 114,367,813 (GRCm39) M1604L possibly damaging Het
Acp3 A G 9: 104,204,174 (GRCm39) V40A possibly damaging Het
Adgrl1 T C 8: 84,661,041 (GRCm39) probably benign Het
Alppl2 C T 1: 87,015,446 (GRCm39) V372I possibly damaging Het
Apol8 C T 15: 77,633,811 (GRCm39) S255N probably benign Het
Atp8b4 A T 2: 126,179,413 (GRCm39) F973I probably damaging Het
Bbs4 A G 9: 59,230,259 (GRCm39) *150Q probably null Het
Bltp3a A T 17: 28,106,152 (GRCm39) T893S probably damaging Het
Cacna1h A T 17: 25,597,749 (GRCm39) probably benign Het
Ccn1 C A 3: 145,353,503 (GRCm39) C353F probably damaging Het
Ccser2 C T 14: 36,630,965 (GRCm39) probably benign Het
Chd9 A G 8: 91,741,832 (GRCm39) E1607G probably benign Het
Clca4b A G 3: 144,621,337 (GRCm39) I579T probably benign Het
Col20a1 T A 2: 180,626,278 (GRCm39) probably benign Het
Creg2 T C 1: 39,664,144 (GRCm39) I205V probably benign Het
Ddx24 C T 12: 103,390,166 (GRCm39) R275H probably damaging Het
Dip2c G A 13: 9,618,699 (GRCm39) A579T probably benign Het
Dnah3 T C 7: 119,551,962 (GRCm39) probably benign Het
Dnah8 G A 17: 30,892,894 (GRCm39) probably null Het
Gckr T C 5: 31,484,259 (GRCm39) probably benign Het
Gpbp1l1 A G 4: 116,438,436 (GRCm39) probably benign Het
Hmcn2 A G 2: 31,281,523 (GRCm39) T1913A probably benign Het
Lmo7 T C 14: 102,158,003 (GRCm39) probably benign Het
Meioc G A 11: 102,570,857 (GRCm39) V863I probably damaging Het
Myh1 A G 11: 67,112,430 (GRCm39) D1799G probably damaging Het
Myh1 A G 11: 67,096,751 (GRCm39) I341V probably benign Het
Myh13 A G 11: 67,235,828 (GRCm39) T664A probably benign Het
Myo3b A C 2: 70,257,193 (GRCm39) D1269A probably damaging Het
Nckap1 A G 2: 80,378,243 (GRCm39) probably null Het
Nr3c2 A G 8: 77,635,297 (GRCm39) probably null Het
Nxpe5 T C 5: 138,238,186 (GRCm39) S249P probably damaging Het
Or52z1 C T 7: 103,436,604 (GRCm39) M293I probably benign Het
Or8k16 A G 2: 85,520,709 (GRCm39) N312S probably benign Het
Or9a4 T C 6: 40,549,139 (GRCm39) V273A probably benign Het
Pitpnm3 G A 11: 71,949,296 (GRCm39) T675I probably damaging Het
Plekhm1 C A 11: 103,285,908 (GRCm39) E176* probably null Het
Prdm11 C A 2: 92,819,567 (GRCm39) probably benign Het
Prodh2 C A 7: 30,205,706 (GRCm39) R218S probably damaging Het
Rps15a T C 7: 117,714,060 (GRCm39) D54G probably benign Het
Sbno2 G T 10: 79,920,093 (GRCm39) T46N possibly damaging Het
Sdk2 A G 11: 113,697,243 (GRCm39) probably benign Het
Slc36a1 A G 11: 55,116,780 (GRCm39) probably benign Het
Spaca6 A T 17: 18,058,653 (GRCm39) E284V possibly damaging Het
Srsf3 C A 17: 29,255,412 (GRCm39) L66I probably damaging Het
Srsf3 T A 17: 29,255,413 (GRCm39) L66Q probably damaging Het
Syne1 T C 10: 4,993,652 (GRCm39) T8363A possibly damaging Het
Trmt1 T A 8: 85,423,481 (GRCm39) L298Q probably damaging Het
Uba6 T C 5: 86,267,260 (GRCm39) I923V possibly damaging Het
Vmn2r106 G A 17: 20,487,859 (GRCm39) H847Y probably benign Het
Vmn2r15 T C 5: 109,445,401 (GRCm39) T8A probably benign Het
Zbtb39 C G 10: 127,578,175 (GRCm39) Q250E probably benign Het
Zbtb41 T G 1: 139,366,769 (GRCm39) F583V probably damaging Het
Zfp938 T A 10: 82,061,253 (GRCm39) I456F probably benign Het
Other mutations in Sema3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Sema3c APN 5 17,899,858 (GRCm39) missense probably damaging 1.00
IGL01528:Sema3c APN 5 17,919,413 (GRCm39) missense probably benign
IGL01618:Sema3c APN 5 17,877,504 (GRCm39) missense probably damaging 1.00
IGL01730:Sema3c APN 5 17,916,434 (GRCm39) missense probably benign 0.01
IGL01762:Sema3c APN 5 17,899,849 (GRCm39) missense possibly damaging 0.81
IGL02049:Sema3c APN 5 17,926,923 (GRCm39) splice site probably benign
IGL02249:Sema3c APN 5 17,867,961 (GRCm39) missense probably damaging 1.00
IGL02657:Sema3c APN 5 17,867,972 (GRCm39) missense probably damaging 1.00
IGL02657:Sema3c APN 5 17,781,866 (GRCm39) start codon destroyed possibly damaging 0.71
IGL03213:Sema3c APN 5 17,899,637 (GRCm39) splice site probably benign
PIT4651001:Sema3c UTSW 5 17,899,731 (GRCm39) missense probably benign 0.37
R0031:Sema3c UTSW 5 17,899,726 (GRCm39) missense probably damaging 1.00
R0558:Sema3c UTSW 5 17,919,413 (GRCm39) missense probably benign 0.00
R1164:Sema3c UTSW 5 17,883,312 (GRCm39) missense probably benign 0.40
R1351:Sema3c UTSW 5 17,883,334 (GRCm39) missense possibly damaging 0.60
R1368:Sema3c UTSW 5 17,883,330 (GRCm39) missense possibly damaging 0.96
R1480:Sema3c UTSW 5 17,887,029 (GRCm39) missense possibly damaging 0.57
R1880:Sema3c UTSW 5 17,932,464 (GRCm39) nonsense probably null
R1916:Sema3c UTSW 5 17,932,399 (GRCm39) missense probably benign 0.06
R3934:Sema3c UTSW 5 17,886,938 (GRCm39) missense probably damaging 0.97
R4284:Sema3c UTSW 5 17,883,345 (GRCm39) missense probably benign 0.01
R4449:Sema3c UTSW 5 17,781,844 (GRCm39) start gained probably benign
R4545:Sema3c UTSW 5 17,899,770 (GRCm39) missense probably benign 0.01
R4546:Sema3c UTSW 5 17,899,770 (GRCm39) missense probably benign 0.01
R4660:Sema3c UTSW 5 17,877,511 (GRCm39) missense probably damaging 1.00
R4890:Sema3c UTSW 5 17,880,157 (GRCm39) missense probably benign 0.00
R4937:Sema3c UTSW 5 17,899,684 (GRCm39) missense probably benign 0.01
R5065:Sema3c UTSW 5 17,932,615 (GRCm39) missense possibly damaging 0.89
R5145:Sema3c UTSW 5 17,932,615 (GRCm39) missense possibly damaging 0.89
R5452:Sema3c UTSW 5 17,922,068 (GRCm39) critical splice donor site probably null
R5586:Sema3c UTSW 5 17,916,422 (GRCm39) missense probably damaging 0.99
R5811:Sema3c UTSW 5 17,880,188 (GRCm39) splice site probably null
R5886:Sema3c UTSW 5 17,886,984 (GRCm39) missense possibly damaging 0.90
R6120:Sema3c UTSW 5 17,932,630 (GRCm39) missense probably benign 0.00
R6191:Sema3c UTSW 5 17,858,804 (GRCm39) missense probably damaging 1.00
R6318:Sema3c UTSW 5 17,877,430 (GRCm39) missense probably damaging 0.96
R6416:Sema3c UTSW 5 17,781,959 (GRCm39) missense probably damaging 0.99
R6441:Sema3c UTSW 5 17,929,130 (GRCm39) missense possibly damaging 0.96
R6816:Sema3c UTSW 5 17,875,463 (GRCm39) missense probably benign 0.36
R7146:Sema3c UTSW 5 17,899,701 (GRCm39) missense probably benign 0.22
R7526:Sema3c UTSW 5 17,932,594 (GRCm39) missense possibly damaging 0.46
R7832:Sema3c UTSW 5 17,899,845 (GRCm39) missense probably damaging 0.99
R8034:Sema3c UTSW 5 17,932,480 (GRCm39) missense probably damaging 1.00
R8053:Sema3c UTSW 5 17,860,020 (GRCm39) missense probably benign 0.00
R8076:Sema3c UTSW 5 17,932,362 (GRCm39) missense probably benign 0.00
R8264:Sema3c UTSW 5 17,881,537 (GRCm39) intron probably benign
R8359:Sema3c UTSW 5 17,858,726 (GRCm39) missense possibly damaging 0.56
R8437:Sema3c UTSW 5 17,867,936 (GRCm39) missense probably damaging 0.99
R9174:Sema3c UTSW 5 17,868,039 (GRCm39) critical splice donor site probably null
R9295:Sema3c UTSW 5 17,932,495 (GRCm39) missense probably benign 0.09
R9477:Sema3c UTSW 5 17,921,981 (GRCm39) missense
R9599:Sema3c UTSW 5 17,919,452 (GRCm39) critical splice donor site probably null
R9702:Sema3c UTSW 5 17,858,828 (GRCm39) missense probably damaging 1.00
Z1176:Sema3c UTSW 5 17,932,517 (GRCm39) missense probably benign 0.04
Z1177:Sema3c UTSW 5 17,922,029 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCTGAGTGAGATAATGAGACTCTCC -3'
(R):5'- GCAACCGTTTGTTCCAGAAGATTTGTG -3'

Sequencing Primer
(F):5'- GAGATAATGAGACTCTCCTATCGGC -3'
(R):5'- GGTTCAGTATTCACATGAAGAGCAC -3'
Posted On 2013-11-07