Incidental Mutation 'R0940:Kank3'
ID81461
Institutional Source Beutler Lab
Gene Symbol Kank3
Ensembl Gene ENSMUSG00000042099
Gene NameKN motif and ankyrin repeat domains 3
Synonyms0610013D04Rik, Ankrd47, D17Ertd288e
MMRRC Submission 039079-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R0940 (G1)
Quality Score105
Status Validated
Chromosome17
Chromosomal Location33810520-33822918 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33817476 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 106 (S106F)
Ref Sequence ENSEMBL: ENSMUSP00000040126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048560] [ENSMUST00000172649] [ENSMUST00000173019] [ENSMUST00000173789]
Predicted Effect probably damaging
Transcript: ENSMUST00000048560
AA Change: S106F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040126
Gene: ENSMUSG00000042099
AA Change: S106F

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Pfam:KN_motif 32 73 9.1e-24 PFAM
low complexity region 105 125 N/A INTRINSIC
low complexity region 138 150 N/A INTRINSIC
coiled coil region 180 229 N/A INTRINSIC
low complexity region 317 362 N/A INTRINSIC
low complexity region 369 385 N/A INTRINSIC
low complexity region 460 478 N/A INTRINSIC
low complexity region 485 498 N/A INTRINSIC
ANK 606 636 3.46e-4 SMART
ANK 640 674 2.88e2 SMART
ANK 679 708 5.41e-6 SMART
ANK 712 742 2.73e-2 SMART
Blast:ANK 746 775 4e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172649
SMART Domains Protein: ENSMUSP00000133760
Gene: ENSMUSG00000042099

DomainStartEndE-ValueType
coiled coil region 8 41 N/A INTRINSIC
low complexity region 129 174 N/A INTRINSIC
low complexity region 181 197 N/A INTRINSIC
low complexity region 272 290 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
ANK 418 448 3.46e-4 SMART
ANK 452 486 2.88e2 SMART
ANK 491 520 5.41e-6 SMART
ANK 524 554 2.73e-2 SMART
Blast:ANK 558 587 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173019
SMART Domains Protein: ENSMUSP00000134615
Gene: ENSMUSG00000067288

DomainStartEndE-ValueType
Pfam:Ribosomal_S28e 1 69 3.6e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173649
Predicted Effect probably benign
Transcript: ENSMUST00000173789
SMART Domains Protein: ENSMUSP00000133625
Gene: ENSMUSG00000042099

DomainStartEndE-ValueType
ANK 22 56 2.88e2 SMART
ANK 61 90 5.41e-6 SMART
ANK 94 124 2.73e-2 SMART
Blast:ANK 128 157 7e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173958
Predicted Effect probably benign
Transcript: ENSMUST00000174608
SMART Domains Protein: ENSMUSP00000134656
Gene: ENSMUSG00000042099

DomainStartEndE-ValueType
SCOP:d1bd8__ 2 47 9e-5 SMART
PDB:4HBD|A 8 48 1e-6 PDB
Blast:ANK 23 52 3e-11 BLAST
Meta Mutation Damage Score 0.1791 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.0%
  • 20x: 96.7%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik C T 9: 22,208,071 noncoding transcript Het
2610021A01Rik T G 7: 41,626,434 I520M probably damaging Het
Ackr4 A G 9: 104,099,632 F39L probably damaging Het
Adgre5 C T 8: 83,733,497 S92N probably damaging Het
Adrb2 T C 18: 62,179,691 D21G probably benign Het
AI464131 A G 4: 41,497,996 Y545H probably damaging Het
Akr1c6 G A 13: 4,436,373 E60K probably benign Het
Bcl7c T A 7: 127,707,331 N96I possibly damaging Het
Brca1 A T 11: 101,532,143 S106R possibly damaging Het
C6 A T 15: 4,735,235 T138S probably benign Het
Cul3 T C 1: 80,322,847 probably benign Het
Dnah8 T A 17: 30,803,243 M3939K probably damaging Het
Dock4 T A 12: 40,631,627 probably benign Het
Dsc2 T G 18: 20,050,059 T101P probably damaging Het
Dynlt1b T C 17: 6,430,250 probably benign Het
E330013P04Rik A G 19: 60,161,922 noncoding transcript Het
Fam160a1 A G 3: 85,665,490 V952A possibly damaging Het
Fggy A G 4: 95,697,001 E39G probably benign Het
Fmo6 A T 1: 162,926,226 C116S probably benign Het
Gadd45a A G 6: 67,036,829 I44T possibly damaging Het
Gmps A G 3: 63,976,322 probably benign Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Hnrnpm G A 17: 33,650,002 R523C probably damaging Het
Inpp5a T C 7: 139,525,738 Y202H probably damaging Het
Lmcd1 A G 6: 112,328,697 D253G probably benign Het
Lrrk2 A T 15: 91,729,081 I803F possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Mycbp2 A T 14: 103,262,693 probably benign Het
Myh4 A T 11: 67,242,863 N243Y probably damaging Het
Nfatc1 C T 18: 80,635,895 M759I probably benign Het
Nipal4 A G 11: 46,150,312 I352T possibly damaging Het
Nomo1 A G 7: 46,033,905 E25G possibly damaging Het
Olfr1221 T A 2: 89,112,075 I146L probably benign Het
Olfr128 A G 17: 37,923,700 I45V probably damaging Het
Olfr1408 A G 1: 173,130,453 S255P probably benign Het
Olfr392 T C 11: 73,814,224 N286S probably damaging Het
Olfr490 T C 7: 108,287,057 D23G probably benign Het
Olfr525 T C 7: 140,323,152 I151T probably benign Het
Pabpn1l A G 8: 122,622,444 V78A probably benign Het
Pde6b T A 5: 108,420,337 I327N possibly damaging Het
Phrf1 T C 7: 141,254,855 probably benign Het
Pkm C T 9: 59,668,535 probably benign Het
Plxna2 G A 1: 194,800,555 V1519I probably benign Het
Ppp2cb T C 8: 33,615,661 probably null Het
Prickle2 A G 6: 92,411,003 Y473H probably benign Het
Prpf3 A G 3: 95,844,223 W389R probably damaging Het
Psme4 G A 11: 30,815,264 E544K possibly damaging Het
Relb A T 7: 19,611,842 D395E probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 A G 11: 119,416,563 N683S probably benign Het
Rtel1 T C 2: 181,322,803 C102R probably benign Het
Sel1l3 C T 5: 53,144,037 probably benign Het
Slc8a2 A G 7: 16,144,962 T458A probably benign Het
Smc3 T A 19: 53,640,909 M931K probably benign Het
Sorbs2 T C 8: 45,796,502 V795A probably benign Het
Tgm3 A G 2: 130,012,406 S2G probably benign Het
Tpbpa T C 13: 60,940,053 T75A probably damaging Het
Trub1 A G 19: 57,485,063 probably benign Het
Uggt2 A G 14: 119,091,192 probably null Het
Ugt2a3 A G 5: 87,327,206 V393A possibly damaging Het
Vav3 T A 3: 109,562,835 M532K possibly damaging Het
Zfp616 A T 11: 74,085,024 K706N probably damaging Het
Zkscan1 T C 5: 138,093,170 F55S probably damaging Het
Other mutations in Kank3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Kank3 APN 17 33821817 missense probably damaging 1.00
IGL01105:Kank3 APN 17 33817401 missense probably damaging 1.00
IGL01106:Kank3 APN 17 33817401 missense probably damaging 1.00
IGL01139:Kank3 APN 17 33817401 missense probably damaging 1.00
IGL01595:Kank3 APN 17 33819180 critical splice donor site probably null
IGL02129:Kank3 APN 17 33817491 missense probably benign
IGL02364:Kank3 APN 17 33818850 missense probably benign
IGL02540:Kank3 APN 17 33819187 unclassified probably benign
R1387:Kank3 UTSW 17 33816231 missense possibly damaging 0.90
R1663:Kank3 UTSW 17 33818375 missense probably benign 0.00
R1738:Kank3 UTSW 17 33817194 missense probably damaging 1.00
R1752:Kank3 UTSW 17 33819817 missense probably damaging 1.00
R4194:Kank3 UTSW 17 33822263 intron probably benign
R4921:Kank3 UTSW 17 33817200 missense probably damaging 1.00
R5001:Kank3 UTSW 17 33821772 missense possibly damaging 0.51
R5011:Kank3 UTSW 17 33822070 missense probably damaging 1.00
R5111:Kank3 UTSW 17 33818181 missense possibly damaging 0.82
R5147:Kank3 UTSW 17 33822202 missense probably damaging 1.00
R5282:Kank3 UTSW 17 33817943 missense probably benign 0.00
R5752:Kank3 UTSW 17 33818063 missense probably benign
R5943:Kank3 UTSW 17 33818401 missense probably damaging 1.00
R6027:Kank3 UTSW 17 33818114 missense possibly damaging 0.71
X0066:Kank3 UTSW 17 33817271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGGAAATCGAGCGTGGCCC -3'
(R):5'- GGTCTCAGGCACGACTTCGGTG -3'

Sequencing Primer
(F):5'- CCTGCCTCTCGCCGAAC -3'
(R):5'- ACTCCACGATCCGAGGTG -3'
Posted On2013-11-07