Mutagenetix > Incidental Mutations

Incidental Mutation 'R0940:Dsc2'

81467

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

039079-MU

Accession Numbers

Genbank: NM_013505; MGI: 103221

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0940 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 20050059 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 101 (T101P)

Ref Sequence

ENSEMBL: ENSMUSP00000123010 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

AlphaFold

P55292

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039247
AA Change: T101P

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: T101P

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075214
AA Change: T101P

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: T101P

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000128464
AA Change: T101P

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331
AA Change: T101P

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Meta Mutation Damage Score

0.4356

Coding Region Coverage

1x: 99.5%
3x: 99.1%
10x: 98.0%
20x: 96.7%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810064F22Rik	C	T	9: 22,208,071		noncoding transcript	Het
2610021A01Rik	T	G	7: 41,626,434	I520M	probably damaging	Het
Ackr4	A	G	9: 104,099,632	F39L	probably damaging	Het
Adgre5	C	T	8: 83,733,497	S92N	probably damaging	Het
Adrb2	T	C	18: 62,179,691	D21G	probably benign	Het
AI464131	A	G	4: 41,497,996	Y545H	probably damaging	Het
Akr1c6	G	A	13: 4,436,373	E60K	probably benign	Het
Bcl7c	T	A	7: 127,707,331	N96I	possibly damaging	Het
Brca1	A	T	11: 101,532,143	S106R	possibly damaging	Het
C6	A	T	15: 4,735,235	T138S	probably benign	Het
Cul3	T	C	1: 80,322,847		probably benign	Het
Dnah8	T	A	17: 30,803,243	M3939K	probably damaging	Het
Dock4	T	A	12: 40,631,627		probably benign	Het
Dynlt1b	T	C	17: 6,430,250		probably benign	Het
E330013P04Rik	A	G	19: 60,161,922		noncoding transcript	Het
Fam160a1	A	G	3: 85,665,490	V952A	possibly damaging	Het
Fggy	A	G	4: 95,697,001	E39G	probably benign	Het
Fmo6	A	T	1: 162,926,226	C116S	probably benign	Het
Gadd45a	A	G	6: 67,036,829	I44T	possibly damaging	Het
Gmps	A	G	3: 63,976,322		probably benign	Het
Gnmt	A	G	17: 46,726,345	L171P	probably damaging	Het
Hnrnpm	G	A	17: 33,650,002	R523C	probably damaging	Het
Inpp5a	T	C	7: 139,525,738	Y202H	probably damaging	Het
Kank3	C	T	17: 33,817,476	S106F	probably damaging	Het
Lmcd1	A	G	6: 112,328,697	D253G	probably benign	Het
Lrrk2	A	T	15: 91,729,081	I803F	possibly damaging	Het
Mybpc2	T	C	7: 44,506,887	K834R	probably benign	Het
Mycbp2	A	T	14: 103,262,693		probably benign	Het
Myh4	A	T	11: 67,242,863	N243Y	probably damaging	Het
Nfatc1	C	T	18: 80,635,895	M759I	probably benign	Het
Nipal4	A	G	11: 46,150,312	I352T	possibly damaging	Het
Nomo1	A	G	7: 46,033,905	E25G	possibly damaging	Het
Olfr1221	T	A	2: 89,112,075	I146L	probably benign	Het
Olfr128	A	G	17: 37,923,700	I45V	probably damaging	Het
Olfr1408	A	G	1: 173,130,453	S255P	probably benign	Het
Olfr392	T	C	11: 73,814,224	N286S	probably damaging	Het
Olfr490	T	C	7: 108,287,057	D23G	probably benign	Het
Olfr525	T	C	7: 140,323,152	I151T	probably benign	Het
Pabpn1l	A	G	8: 122,622,444	V78A	probably benign	Het
Pde6b	T	A	5: 108,420,337	I327N	possibly damaging	Het
Phrf1	T	C	7: 141,254,855		probably benign	Het
Pkm	C	T	9: 59,668,535		probably benign	Het
Plxna2	G	A	1: 194,800,555	V1519I	probably benign	Het
Ppp2cb	T	C	8: 33,615,661		probably null	Het
Prickle2	A	G	6: 92,411,003	Y473H	probably benign	Het
Prpf3	A	G	3: 95,844,223	W389R	probably damaging	Het
Psme4	G	A	11: 30,815,264	E544K	possibly damaging	Het
Relb	A	T	7: 19,611,842	D395E	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rnf213	A	G	11: 119,416,563	N683S	probably benign	Het
Rtel1	T	C	2: 181,322,803	C102R	probably benign	Het
Sel1l3	C	T	5: 53,144,037		probably benign	Het
Slc8a2	A	G	7: 16,144,962	T458A	probably benign	Het
Smc3	T	A	19: 53,640,909	M931K	probably benign	Het
Sorbs2	T	C	8: 45,796,502	V795A	probably benign	Het
Tgm3	A	G	2: 130,012,406	S2G	probably benign	Het
Tpbpa	T	C	13: 60,940,053	T75A	probably damaging	Het
Trub1	A	G	19: 57,485,063		probably benign	Het
Uggt2	A	G	14: 119,091,192		probably null	Het
Ugt2a3	A	G	5: 87,327,206	V393A	possibly damaging	Het
Vav3	T	A	3: 109,562,835	M532K	possibly damaging	Het
Zfp616	A	T	11: 74,085,024	K706N	probably damaging	Het
Zkscan1	T	C	5: 138,093,170	F55S	probably damaging	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7998:Dsc2	UTSW	18	20034663	missense	possibly damaging	0.87
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8032:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8061:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8082:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8090:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8114:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8115:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8116:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8117:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8118:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8328:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.68
R8545:Dsc2	UTSW	18	20034665	nonsense	probably null
R9005:Dsc2	UTSW	18	20038094	missense	probably benign	0.00
R9017:Dsc2	UTSW	18	20043911	missense	probably damaging	1.00
R9111:Dsc2	UTSW	18	20034707	missense	probably benign	0.00
R9396:Dsc2	UTSW	18	20041716	nonsense	probably null
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGTGCATCCCCAAAATCAAAGTG -3'
(R):5'- AGTGAACCTGATGGACTGCCTTAAATC -3'

Sequencing Primer
(F):5'- CATGTGAAGCTTATCCCAAAGG -3'
(R):5'- CAGCAGACATAGTTCATCTGAGTG -3'

Posted On

2013-11-07