Incidental Mutation 'R0940:Nfatc1'
ID81471
Institutional Source Beutler Lab
Gene Symbol Nfatc1
Ensembl Gene ENSMUSG00000033016
Gene Namenuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1
SynonymsNFATc, NFAT2, 2210017P03Rik, NF-ATc
MMRRC Submission 039079-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0940 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location80606205-80713071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80635895 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 759 (M759I)
Ref Sequence ENSEMBL: ENSMUSP00000129001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078049] [ENSMUST00000167977] [ENSMUST00000170905]
Predicted Effect probably benign
Transcript: ENSMUST00000078049
AA Change: M759I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000077196
Gene: ENSMUSG00000033016
AA Change: M759I

DomainStartEndE-ValueType
low complexity region 170 202 N/A INTRINSIC
low complexity region 277 293 N/A INTRINSIC
Pfam:RHD 429 589 1.3e-27 PFAM
IPT 596 695 8.99e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167977
AA Change: M745I

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000126884
Gene: ENSMUSG00000033016
AA Change: M745I

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 156 188 N/A INTRINSIC
low complexity region 263 279 N/A INTRINSIC
Pfam:RHD 415 575 4.9e-28 PFAM
IPT 582 681 8.99e-21 SMART
low complexity region 832 841 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170905
AA Change: M759I

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000129001
Gene: ENSMUSG00000033016
AA Change: M759I

DomainStartEndE-ValueType
low complexity region 170 202 N/A INTRINSIC
low complexity region 277 293 N/A INTRINSIC
Pfam:RHD_DNA_bind 429 589 5.1e-28 PFAM
IPT 596 695 8.99e-21 SMART
low complexity region 846 855 N/A INTRINSIC
Meta Mutation Damage Score 0.0637 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.0%
  • 20x: 96.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the nuclear factor of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation, and an inducible nuclear component. Proteins belonging to this family of transcription factors play a central role in inducible gene transcription during immune response. The product of this gene is an inducible nuclear component. It functions as a major molecular target for the immunosuppressive drugs such as cyclosporin A. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Different isoforms of this protein may regulate inducible expression of different cytokine genes. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality throughout fetal growth and development due to cardiac failure. Mutants exhibit blood circulation, cardiac valve and ventricular septal abnormalities, edema, abdominal hemorrhage, and semilunar valveregurgitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik C T 9: 22,208,071 noncoding transcript Het
2610021A01Rik T G 7: 41,626,434 I520M probably damaging Het
Ackr4 A G 9: 104,099,632 F39L probably damaging Het
Adgre5 C T 8: 83,733,497 S92N probably damaging Het
Adrb2 T C 18: 62,179,691 D21G probably benign Het
AI464131 A G 4: 41,497,996 Y545H probably damaging Het
Akr1c6 G A 13: 4,436,373 E60K probably benign Het
Bcl7c T A 7: 127,707,331 N96I possibly damaging Het
Brca1 A T 11: 101,532,143 S106R possibly damaging Het
C6 A T 15: 4,735,235 T138S probably benign Het
Cul3 T C 1: 80,322,847 probably benign Het
Dnah8 T A 17: 30,803,243 M3939K probably damaging Het
Dock4 T A 12: 40,631,627 probably benign Het
Dsc2 T G 18: 20,050,059 T101P probably damaging Het
Dynlt1b T C 17: 6,430,250 probably benign Het
E330013P04Rik A G 19: 60,161,922 noncoding transcript Het
Fam160a1 A G 3: 85,665,490 V952A possibly damaging Het
Fggy A G 4: 95,697,001 E39G probably benign Het
Fmo6 A T 1: 162,926,226 C116S probably benign Het
Gadd45a A G 6: 67,036,829 I44T possibly damaging Het
Gmps A G 3: 63,976,322 probably benign Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Hnrnpm G A 17: 33,650,002 R523C probably damaging Het
Inpp5a T C 7: 139,525,738 Y202H probably damaging Het
Kank3 C T 17: 33,817,476 S106F probably damaging Het
Lmcd1 A G 6: 112,328,697 D253G probably benign Het
Lrrk2 A T 15: 91,729,081 I803F possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Mycbp2 A T 14: 103,262,693 probably benign Het
Myh4 A T 11: 67,242,863 N243Y probably damaging Het
Nipal4 A G 11: 46,150,312 I352T possibly damaging Het
Nomo1 A G 7: 46,033,905 E25G possibly damaging Het
Olfr1221 T A 2: 89,112,075 I146L probably benign Het
Olfr128 A G 17: 37,923,700 I45V probably damaging Het
Olfr1408 A G 1: 173,130,453 S255P probably benign Het
Olfr392 T C 11: 73,814,224 N286S probably damaging Het
Olfr490 T C 7: 108,287,057 D23G probably benign Het
Olfr525 T C 7: 140,323,152 I151T probably benign Het
Pabpn1l A G 8: 122,622,444 V78A probably benign Het
Pde6b T A 5: 108,420,337 I327N possibly damaging Het
Phrf1 T C 7: 141,254,855 probably benign Het
Pkm C T 9: 59,668,535 probably benign Het
Plxna2 G A 1: 194,800,555 V1519I probably benign Het
Ppp2cb T C 8: 33,615,661 probably null Het
Prickle2 A G 6: 92,411,003 Y473H probably benign Het
Prpf3 A G 3: 95,844,223 W389R probably damaging Het
Psme4 G A 11: 30,815,264 E544K possibly damaging Het
Relb A T 7: 19,611,842 D395E probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 A G 11: 119,416,563 N683S probably benign Het
Rtel1 T C 2: 181,322,803 C102R probably benign Het
Sel1l3 C T 5: 53,144,037 probably benign Het
Slc8a2 A G 7: 16,144,962 T458A probably benign Het
Smc3 T A 19: 53,640,909 M931K probably benign Het
Sorbs2 T C 8: 45,796,502 V795A probably benign Het
Tgm3 A G 2: 130,012,406 S2G probably benign Het
Tpbpa T C 13: 60,940,053 T75A probably damaging Het
Trub1 A G 19: 57,485,063 probably benign Het
Uggt2 A G 14: 119,091,192 probably null Het
Ugt2a3 A G 5: 87,327,206 V393A possibly damaging Het
Vav3 T A 3: 109,562,835 M532K possibly damaging Het
Zfp616 A T 11: 74,085,024 K706N probably damaging Het
Zkscan1 T C 5: 138,093,170 F55S probably damaging Het
Other mutations in Nfatc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Nfatc1 APN 18 80667026 missense probably damaging 1.00
IGL00742:Nfatc1 APN 18 80698014 missense probably benign 0.20
IGL01510:Nfatc1 APN 18 80698188 missense probably damaging 1.00
IGL01790:Nfatc1 APN 18 80667042 missense probably damaging 1.00
IGL02548:Nfatc1 APN 18 80697898 missense probably damaging 1.00
goldfeld UTSW 18 80697832 missense probably damaging 0.99
original UTSW 18 80653564 splice site probably null
R0019:Nfatc1 UTSW 18 80635504 missense probably benign
R0411:Nfatc1 UTSW 18 80698042 missense possibly damaging 0.88
R0738:Nfatc1 UTSW 18 80697910 missense probably damaging 1.00
R1458:Nfatc1 UTSW 18 80665267 splice site probably benign
R1622:Nfatc1 UTSW 18 80666967 missense probably damaging 1.00
R1845:Nfatc1 UTSW 18 80635531 missense possibly damaging 0.67
R2110:Nfatc1 UTSW 18 80635664 nonsense probably null
R2112:Nfatc1 UTSW 18 80635664 nonsense probably null
R2157:Nfatc1 UTSW 18 80635845 missense possibly damaging 0.88
R3857:Nfatc1 UTSW 18 80665275 splice site probably benign
R3859:Nfatc1 UTSW 18 80665275 splice site probably benign
R4108:Nfatc1 UTSW 18 80698368 missense possibly damaging 0.68
R4510:Nfatc1 UTSW 18 80635579 missense probably damaging 0.96
R4511:Nfatc1 UTSW 18 80635579 missense probably damaging 0.96
R4618:Nfatc1 UTSW 18 80697832 missense probably damaging 0.99
R4850:Nfatc1 UTSW 18 80697865 missense probably benign 0.30
R5329:Nfatc1 UTSW 18 80708117 start codon destroyed probably null
R5395:Nfatc1 UTSW 18 80636020 missense possibly damaging 0.80
R5468:Nfatc1 UTSW 18 80649855 missense probably benign 0.00
R5522:Nfatc1 UTSW 18 80653529 missense probably benign 0.36
R5568:Nfatc1 UTSW 18 80649822 missense probably benign 0.12
R6111:Nfatc1 UTSW 18 80697910 missense probably damaging 1.00
R6190:Nfatc1 UTSW 18 80712670 missense probably benign 0.21
R6397:Nfatc1 UTSW 18 80635941 missense probably damaging 1.00
R6943:Nfatc1 UTSW 18 80635555 missense probably damaging 1.00
R6970:Nfatc1 UTSW 18 80667013 missense probably benign 0.34
R6994:Nfatc1 UTSW 18 80653564 splice site probably null
R7679:Nfatc1 UTSW 18 80607990 missense probably benign
R7703:Nfatc1 UTSW 18 80682289 missense probably damaging 1.00
X0062:Nfatc1 UTSW 18 80697618 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GCTACTGTTCAGATGTGGACTCACC -3'
(R):5'- TGTGACTTTCTCAGCCAGTGACG -3'

Sequencing Primer
(F):5'- CTGTAGCCTGGCGGATG -3'
(R):5'- AGCCTACCCATCTGCAACTTATG -3'
Posted On2013-11-07