Incidental Mutation 'R0964:Prodh2'
ID81474
Institutional Source Beutler Lab
Gene Symbol Prodh2
Ensembl Gene ENSMUSG00000036892
Gene Nameproline dehydrogenase (oxidase) 2
Synonyms2510028N04Rik, POX1, 2510038B11Rik, MmPOX1
MMRRC Submission 039093-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R0964 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30493622-30513402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 30506281 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 218 (R218S)
Ref Sequence ENSEMBL: ENSMUSP00000122546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058280] [ENSMUST00000130839] [ENSMUST00000131040] [ENSMUST00000133318] [ENSMUST00000142575]
Predicted Effect probably damaging
Transcript: ENSMUST00000058280
AA Change: R220S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062214
Gene: ENSMUSG00000036892
AA Change: R220S

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
Pfam:Pro_dh 87 440 3.4e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122876
SMART Domains Protein: ENSMUSP00000114278
Gene: ENSMUSG00000036892

DomainStartEndE-ValueType
Pfam:Pro_dh 1 82 2.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130839
SMART Domains Protein: ENSMUSP00000117480
Gene: ENSMUSG00000036892

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
low complexity region 97 112 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131040
AA Change: R159S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116662
Gene: ENSMUSG00000036892
AA Change: R159S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 33 47 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
Pfam:Pro_dh 91 260 5e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133318
AA Change: R218S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122546
Gene: ENSMUSG00000036892
AA Change: R218S

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
low complexity region 63 77 N/A INTRINSIC
low complexity region 95 110 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142514
Predicted Effect probably damaging
Transcript: ENSMUST00000142575
AA Change: R206S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114778
Gene: ENSMUSG00000036892
AA Change: R206S

DomainStartEndE-ValueType
low complexity region 57 68 N/A INTRINSIC
Pfam:Pro_dh 147 284 6.5e-14 PFAM
Meta Mutation Damage Score 0.4792 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the first step in the catabolism of trans-4-hydroxy-L-proline, an amino acid derivative obtained through food intake and collagen turnover. One of the downstream products of this catabolism is glyoxylate, which in people with disorders of glyoxalate metabolism can lead to an increase in oxalate levels and the formation of calcium-oxalate kidney stones. Therefore, this gene may serve as a therapeutic target against primary hyperoxalurias (PH). This gene is similar to proline dehydrogenase (oxidase) 1, a mitochondrial enzyme that catalyzes the first step in proline catabolism. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Acacb A T 5: 114,229,752 M1604L possibly damaging Het
Acpp A G 9: 104,326,975 V40A possibly damaging Het
Adgrl1 T C 8: 83,934,412 probably benign Het
Alppl2 C T 1: 87,087,724 V372I possibly damaging Het
Apol8 C T 15: 77,749,611 S255N probably benign Het
Atp8b4 A T 2: 126,337,493 F973I probably damaging Het
Bbs4 A G 9: 59,322,976 *150Q probably null Het
Cacna1h A T 17: 25,378,775 probably benign Het
Ccser2 C T 14: 36,909,008 probably benign Het
Chd9 A G 8: 91,015,204 E1607G probably benign Het
Clca4b A G 3: 144,915,576 I579T probably benign Het
Col20a1 T A 2: 180,984,485 probably benign Het
Creg2 T C 1: 39,624,976 I205V probably benign Het
Cyr61 C A 3: 145,647,748 C353F probably damaging Het
Ddx24 C T 12: 103,423,907 R275H probably damaging Het
Dip2c G A 13: 9,568,663 A579T probably benign Het
Dnah3 T C 7: 119,952,739 probably benign Het
Dnah8 G A 17: 30,673,920 probably null Het
Gckr T C 5: 31,326,915 probably benign Het
Gpbp1l1 A G 4: 116,581,239 probably benign Het
Hmcn2 A G 2: 31,391,511 T1913A probably benign Het
Lmo7 T C 14: 101,920,567 probably benign Het
Meioc G A 11: 102,680,031 V863I probably damaging Het
Myh1 A G 11: 67,205,925 I341V probably benign Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Myh13 A G 11: 67,345,002 T664A probably benign Het
Myo3b A C 2: 70,426,849 D1269A probably damaging Het
Nckap1 A G 2: 80,547,899 probably null Het
Nr3c2 A G 8: 76,908,668 probably null Het
Nxpe5 T C 5: 138,239,924 S249P probably damaging Het
Olfr1008 A G 2: 85,690,365 N312S probably benign Het
Olfr460 T C 6: 40,572,205 V273A probably benign Het
Olfr67 C T 7: 103,787,397 M293I probably benign Het
Pitpnm3 G A 11: 72,058,470 T675I probably damaging Het
Plekhm1 C A 11: 103,395,082 E176* probably null Het
Prdm11 C A 2: 92,989,222 probably benign Het
Rps15a T C 7: 118,114,837 D54G probably benign Het
Sbno2 G T 10: 80,084,259 T46N possibly damaging Het
Sdk2 A G 11: 113,806,417 probably benign Het
Sema3c T C 5: 17,721,909 F567L probably damaging Het
Slc36a1 A G 11: 55,225,954 probably benign Het
Spaca6 A T 17: 17,838,391 E284V possibly damaging Het
Srsf3 C A 17: 29,036,438 L66I probably damaging Het
Srsf3 T A 17: 29,036,439 L66Q probably damaging Het
Syne1 T C 10: 5,043,652 T8363A possibly damaging Het
Trmt1 T A 8: 84,696,852 L298Q probably damaging Het
Uba6 T C 5: 86,119,401 I923V possibly damaging Het
Uhrf1bp1 A T 17: 27,887,178 T893S probably damaging Het
Vmn2r106 G A 17: 20,267,597 H847Y probably benign Het
Vmn2r15 T C 5: 109,297,535 T8A probably benign Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Zbtb41 T G 1: 139,439,031 F583V probably damaging Het
Zfp938 T A 10: 82,225,419 I456F probably benign Het
Other mutations in Prodh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01720:Prodh2 APN 7 30511203 missense probably damaging 1.00
IGL01949:Prodh2 APN 7 30509765 critical splice acceptor site probably null
IGL02119:Prodh2 APN 7 30506504 missense probably damaging 1.00
IGL02334:Prodh2 APN 7 30506378 missense probably damaging 0.99
IGL03061:Prodh2 APN 7 30512833 nonsense probably null
R0831:Prodh2 UTSW 7 30494224 nonsense probably null
R1295:Prodh2 UTSW 7 30494089 missense probably damaging 1.00
R4414:Prodh2 UTSW 7 30506452 missense probably damaging 1.00
R5035:Prodh2 UTSW 7 30506479 missense possibly damaging 0.49
R5461:Prodh2 UTSW 7 30494523 missense possibly damaging 0.92
R5643:Prodh2 UTSW 7 30506746 missense possibly damaging 0.65
R6276:Prodh2 UTSW 7 30506651 missense probably benign 0.07
R6876:Prodh2 UTSW 7 30506500 missense probably damaging 1.00
R7860:Prodh2 UTSW 7 30512639 splice site probably null
R7972:Prodh2 UTSW 7 30511155 missense probably damaging 1.00
R8040:Prodh2 UTSW 7 30506411 missense probably damaging 1.00
X0026:Prodh2 UTSW 7 30493775 missense possibly damaging 0.83
Z1177:Prodh2 UTSW 7 30493990 missense probably damaging 1.00
Z1186:Prodh2 UTSW 7 30506644 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTCAGCCTCCCAAATTGTGAGACTG -3'
(R):5'- TGCAGAGCACATGGACAGACTCAG -3'

Sequencing Primer
(F):5'- TGGCATCCTGTCCTGCAAG -3'
(R):5'- AGGTTGCTGAGTTCCCAC -3'
Posted On2013-11-07