Incidental Mutation 'R0971:Rgma'
ID81500
Institutional Source Beutler Lab
Gene Symbol Rgma
Ensembl Gene ENSMUSG00000070509
Gene Namerepulsive guidance molecule family member A
SynonymsRGM domain family, member A
MMRRC Submission 039100-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R0971 (G1)
Quality Score168
Status Not validated
Chromosome7
Chromosomal Location73375509-73419899 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 73391498 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094312] [ENSMUST00000119206] [ENSMUST00000128471] [ENSMUST00000139780]
Predicted Effect probably null
Transcript: ENSMUST00000094312
SMART Domains Protein: ENSMUSP00000091870
Gene: ENSMUSG00000070509

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:RGM_N 48 223 6.6e-74 PFAM
Pfam:RGM_C 227 410 1.5e-75 PFAM
low complexity region 422 430 N/A INTRINSIC
low complexity region 439 453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119206
SMART Domains Protein: ENSMUSP00000112599
Gene: ENSMUSG00000070509

DomainStartEndE-ValueType
Pfam:RGM_N 1 113 3.8e-45 PFAM
Pfam:RGM_C 117 302 1.8e-76 PFAM
low complexity region 312 320 N/A INTRINSIC
low complexity region 329 343 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000128471
SMART Domains Protein: ENSMUSP00000116552
Gene: ENSMUSG00000070509

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:RGM_N 32 101 7.5e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000139780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206253
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the repulsive guidance molecule family. The encoded protein is a glycosylphosphatidylinositol-anchored glycoprotein that functions as an axon guidance protein in the developing and adult central nervous system. This protein may also function as a tumor suppressor in some cancers. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Inactivation of this locus results in impaired cephalic closure and subsequent exencephaly, both with incomplete penetrance. The retinal topography of the visual system is normal in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 G A 7: 81,092,579 E715K possibly damaging Het
Cbr2 T A 11: 120,730,433 I147F probably benign Het
Chdh A G 14: 30,033,663 N302S probably damaging Het
Cog5 T A 12: 31,919,678 H732Q probably benign Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Itln1 C A 1: 171,529,204 V236F probably damaging Het
Itpr1 A G 6: 108,349,629 E104G possibly damaging Het
Kcnh8 T A 17: 52,725,899 F71L probably benign Het
Kif14 T C 1: 136,519,654 M1399T probably damaging Het
Kif21a A G 15: 90,940,581 V1324A possibly damaging Het
Klhdc7b A T 15: 89,387,054 H713L possibly damaging Het
Opn5 C T 17: 42,611,327 probably null Het
Poteg A T 8: 27,447,939 Y41F probably damaging Het
Prpmp5 T A 6: 132,313,655 D27V unknown Het
Psd2 C A 18: 35,979,786 T178K probably damaging Het
Ptch1 T C 13: 63,539,843 T374A probably benign Het
Tmem120a A G 5: 135,736,104 L272P probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vmn1r40 A T 6: 89,714,290 I30F probably benign Het
Vps33b A G 7: 80,287,899 D465G possibly damaging Het
Zan G A 5: 137,434,063 A2324V unknown Het
Other mutations in Rgma
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Rgma APN 7 73417491 missense probably damaging 1.00
IGL01089:Rgma APN 7 73409714 missense possibly damaging 0.79
IGL01336:Rgma APN 7 73409318 missense possibly damaging 0.61
IGL01339:Rgma APN 7 73417483 missense probably damaging 1.00
IGL01340:Rgma APN 7 73417330 missense probably damaging 1.00
IGL02034:Rgma APN 7 73417433 missense probably damaging 0.99
IGL03003:Rgma APN 7 73417440 missense probably damaging 0.97
IGL03050:Rgma UTSW 7 73417515 missense probably damaging 1.00
R0173:Rgma UTSW 7 73417554 missense probably damaging 1.00
R0630:Rgma UTSW 7 73417618 missense probably damaging 1.00
R0691:Rgma UTSW 7 73409412 missense probably damaging 0.99
R0696:Rgma UTSW 7 73409412 missense probably damaging 0.99
R1394:Rgma UTSW 7 73417794 missense probably benign 0.06
R1395:Rgma UTSW 7 73417794 missense probably benign 0.06
R1707:Rgma UTSW 7 73417959 missense unknown
R1731:Rgma UTSW 7 73409412 missense probably damaging 0.99
R1792:Rgma UTSW 7 73417837 missense probably damaging 0.97
R2068:Rgma UTSW 7 73409631 missense probably damaging 0.98
R2327:Rgma UTSW 7 73417826 missense probably damaging 1.00
R4707:Rgma UTSW 7 73417816 missense probably damaging 1.00
R5976:Rgma UTSW 7 73409468 missense probably damaging 0.97
R6458:Rgma UTSW 7 73409694 missense probably damaging 1.00
R6702:Rgma UTSW 7 73417320 missense probably damaging 1.00
R7123:Rgma UTSW 7 73409391 missense probably damaging 1.00
R7767:Rgma UTSW 7 73418004 missense unknown
V7732:Rgma UTSW 7 73417320 missense probably damaging 1.00
Z1177:Rgma UTSW 7 73409675 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTTCTCCGCAGCGTGATTGA -3'
(R):5'- ATTAGCACGTCTGAGCCTGTGTCC -3'

Sequencing Primer
(F):5'- AGCGTGATTGATTTTTTTTTCCTC -3'
(R):5'- GGCTACCAACAGGTTTTGC -3'
Posted On2013-11-07