Incidental Mutation 'R0971:Cbr2'
ID81510
Institutional Source Beutler Lab
Gene Symbol Cbr2
Ensembl Gene ENSMUSG00000025150
Gene Namecarbonyl reductase 2
SynonymsMLCR, lung carbonyl reductase
MMRRC Submission 039100-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0971 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120729489-120732114 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120730433 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 147 (I147F)
Ref Sequence ENSEMBL: ENSMUSP00000026148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026144] [ENSMUST00000026148] [ENSMUST00000106148]
PDB Structure
CARBONYL REDUCTASE COMPLEXED WITH NADPH AND 2-PROPANOL [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000026144
SMART Domains Protein: ENSMUSP00000026144
Gene: ENSMUSG00000039450

DomainStartEndE-ValueType
Pfam:adh_short 8 195 8.9e-51 PFAM
Pfam:KR 9 175 7.1e-9 PFAM
Pfam:Epimerase 10 227 2.3e-7 PFAM
Pfam:adh_short_C2 14 242 6.3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026148
AA Change: I147F

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000026148
Gene: ENSMUSG00000025150
AA Change: I147F

DomainStartEndE-ValueType
Pfam:KR 9 178 8.5e-8 PFAM
Pfam:adh_short 9 195 4.6e-55 PFAM
Pfam:adh_short_C2 14 242 9.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106148
SMART Domains Protein: ENSMUSP00000101754
Gene: ENSMUSG00000039450

DomainStartEndE-ValueType
Pfam:adh_short 8 151 2.1e-22 PFAM
Pfam:KR 9 151 4.7e-7 PFAM
Pfam:NAD_binding_10 11 182 3.9e-9 PFAM
Pfam:adh_short_C2 14 150 2.2e-8 PFAM
Pfam:adh_short_C2 157 234 4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154479
Predicted Effect unknown
Transcript: ENSMUST00000154565
AA Change: I74F
SMART Domains Protein: ENSMUSP00000117739
Gene: ENSMUSG00000025150
AA Change: I74F

DomainStartEndE-ValueType
Pfam:adh_short 1 45 6.2e-10 PFAM
Pfam:adh_short_C2 33 154 9.7e-18 PFAM
Pfam:adh_short 41 123 2.2e-23 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 G A 7: 81,092,579 E715K possibly damaging Het
Chdh A G 14: 30,033,663 N302S probably damaging Het
Cog5 T A 12: 31,919,678 H732Q probably benign Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Itln1 C A 1: 171,529,204 V236F probably damaging Het
Itpr1 A G 6: 108,349,629 E104G possibly damaging Het
Kcnh8 T A 17: 52,725,899 F71L probably benign Het
Kif14 T C 1: 136,519,654 M1399T probably damaging Het
Kif21a A G 15: 90,940,581 V1324A possibly damaging Het
Klhdc7b A T 15: 89,387,054 H713L possibly damaging Het
Opn5 C T 17: 42,611,327 probably null Het
Poteg A T 8: 27,447,939 Y41F probably damaging Het
Prpmp5 T A 6: 132,313,655 D27V unknown Het
Psd2 C A 18: 35,979,786 T178K probably damaging Het
Ptch1 T C 13: 63,539,843 T374A probably benign Het
Rgma T C 7: 73,391,498 probably null Het
Tmem120a A G 5: 135,736,104 L272P probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vmn1r40 A T 6: 89,714,290 I30F probably benign Het
Vps33b A G 7: 80,287,899 D465G possibly damaging Het
Zan G A 5: 137,434,063 A2324V unknown Het
Other mutations in Cbr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0211:Cbr2 UTSW 11 120730788 missense probably benign
R0211:Cbr2 UTSW 11 120730788 missense probably benign
R1573:Cbr2 UTSW 11 120731965 missense possibly damaging 0.70
R2093:Cbr2 UTSW 11 120730429 missense probably benign 0.00
R3828:Cbr2 UTSW 11 120730452 missense probably benign
R3829:Cbr2 UTSW 11 120730452 missense probably benign
R4403:Cbr2 UTSW 11 120730802 missense probably damaging 1.00
R5011:Cbr2 UTSW 11 120730871 missense possibly damaging 0.92
R7199:Cbr2 UTSW 11 120730261 missense probably benign 0.00
R7535:Cbr2 UTSW 11 120729802 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTGGTCAGCATAGTCATCGCTC -3'
(R):5'- AATGCAGCCCTTCCTGGAAGTTAC -3'

Sequencing Primer
(F):5'- AGCATAGTCATCGCTCCCTTG -3'
(R):5'- GTTACCAAGGAAGCCTTTGAC -3'
Posted On2013-11-07