Incidental Mutation 'R0971:Cog5'
ID81511
Institutional Source Beutler Lab
Gene Symbol Cog5
Ensembl Gene ENSMUSG00000035933
Gene Namecomponent of oligomeric golgi complex 5
Synonyms5430405C01Rik, GOLTC1, GTC90
MMRRC Submission 039100-MU
Accession Numbers

Ensembl: ENSMUST00000036862; MGI: 2145130

Is this an essential gene? Probably essential (E-score: 0.894) question?
Stock #R0971 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location31654869-31937630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31919678 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 732 (H732Q)
Ref Sequence ENSEMBL: ENSMUSP00000044797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036862] [ENSMUST00000218428]
Predicted Effect probably benign
Transcript: ENSMUST00000036862
AA Change: H732Q

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000044797
Gene: ENSMUSG00000035933
AA Change: H732Q

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Pfam:COG5 35 158 3.8e-37 PFAM
Pfam:Vps51 37 120 1.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218428
AA Change: H2Q

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219672
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of eight proteins (Cog1-8) which form a Golgi-localized complex (COG) required for normal Golgi morphology and function. The encoded protein is organized with conserved oligomeric Golgi complex components 6, 7 and 8 into a sub-complex referred to as lobe B. Alternative splicing results in multiple transcript variants. Mutations in this gene result in congenital disorder of glycosylation type 2I.[provided by RefSeq, Jan 2011]
Allele List at MGI

All alleles(99) : Gene trapped(99)

Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 G A 7: 81,092,579 E715K possibly damaging Het
Cbr2 T A 11: 120,730,433 I147F probably benign Het
Chdh A G 14: 30,033,663 N302S probably damaging Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Itln1 C A 1: 171,529,204 V236F probably damaging Het
Itpr1 A G 6: 108,349,629 E104G possibly damaging Het
Kcnh8 T A 17: 52,725,899 F71L probably benign Het
Kif14 T C 1: 136,519,654 M1399T probably damaging Het
Kif21a A G 15: 90,940,581 V1324A possibly damaging Het
Klhdc7b A T 15: 89,387,054 H713L possibly damaging Het
Opn5 C T 17: 42,611,327 probably null Het
Poteg A T 8: 27,447,939 Y41F probably damaging Het
Prpmp5 T A 6: 132,313,655 D27V unknown Het
Psd2 C A 18: 35,979,786 T178K probably damaging Het
Ptch1 T C 13: 63,539,843 T374A probably benign Het
Rgma T C 7: 73,391,498 probably null Het
Tmem120a A G 5: 135,736,104 L272P probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vmn1r40 A T 6: 89,714,290 I30F probably benign Het
Vps33b A G 7: 80,287,899 D465G possibly damaging Het
Zan G A 5: 137,434,063 A2324V unknown Het
Other mutations in Cog5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cog5 APN 12 31685704 missense probably damaging 1.00
IGL00495:Cog5 APN 12 31837309 missense probably benign 0.06
IGL00763:Cog5 APN 12 31665532 splice site probably benign
IGL00789:Cog5 APN 12 31760952 missense possibly damaging 0.95
IGL01288:Cog5 APN 12 31886206 missense probably benign 0.13
IGL01315:Cog5 APN 12 31760986 splice site probably benign
IGL01396:Cog5 APN 12 31894096 missense probably benign 0.01
IGL02468:Cog5 APN 12 31837358 critical splice donor site probably null
IGL03030:Cog5 APN 12 31790922 missense probably damaging 0.99
IGL03346:Cog5 APN 12 31894038 missense possibly damaging 0.88
R0201:Cog5 UTSW 12 31839841 missense probably damaging 0.99
R0356:Cog5 UTSW 12 31837181 splice site probably benign
R0492:Cog5 UTSW 12 31869461 missense probably damaging 1.00
R0646:Cog5 UTSW 12 31837359 splice site probably benign
R1158:Cog5 UTSW 12 31870057 splice site probably benign
R1997:Cog5 UTSW 12 31660849 missense possibly damaging 0.66
R2167:Cog5 UTSW 12 31837289 missense probably damaging 0.99
R4414:Cog5 UTSW 12 31660854 nonsense probably null
R4755:Cog5 UTSW 12 31869406 splice site probably null
R4836:Cog5 UTSW 12 31919733 missense probably benign 0.07
R5017:Cog5 UTSW 12 31920605 missense probably benign 0.29
R5256:Cog5 UTSW 12 31886205 missense probably benign
R5986:Cog5 UTSW 12 31660717 missense probably benign 0.03
R6131:Cog5 UTSW 12 31886221 missense possibly damaging 0.47
R6885:Cog5 UTSW 12 31894199 missense probably damaging 1.00
R7056:Cog5 UTSW 12 31665469 missense possibly damaging 0.65
R7177:Cog5 UTSW 12 31760889 missense probably damaging 1.00
R7182:Cog5 UTSW 12 31685708 missense probably damaging 1.00
R7418:Cog5 UTSW 12 31833241 missense probably damaging 1.00
R7445:Cog5 UTSW 12 31919672 missense possibly damaging 0.64
X0062:Cog5 UTSW 12 31685692 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTACACCAGCGTGGGTGTTCTG -3'
(R):5'- ACTCACTAAAGCTGGAGGGAGCC -3'

Sequencing Primer
(F):5'- tgggaggcagaggcagg -3'
(R):5'- GAGCCAGCAGCCCACTC -3'
Posted On2013-11-07