Incidental Mutation 'R0918:Cerkl'
ID81524
Institutional Source Beutler Lab
Gene Symbol Cerkl
Ensembl Gene ENSMUSG00000075256
Gene Nameceramide kinase-like
SynonymsRp26
MMRRC Submission 039068-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.402) question?
Stock #R0918 (G1)
Quality Score142
Status Not validated
Chromosome2
Chromosomal Location79330543-79456785 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79333629 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 449 (I449T)
Ref Sequence ENSEMBL: ENSMUSP00000114325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099972] [ENSMUST00000143974] [ENSMUST00000156731]
Predicted Effect probably benign
Transcript: ENSMUST00000099972
SMART Domains Protein: ENSMUSP00000099718
Gene: ENSMUSG00000027009

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Int_alpha 48 108 5.14e-7 SMART
Int_alpha 191 241 3.45e1 SMART
Int_alpha 247 300 1.89e-5 SMART
Int_alpha 302 358 2.25e-12 SMART
Int_alpha 364 419 1.45e-15 SMART
Int_alpha 426 483 4.52e-3 SMART
SCOP:d1m1xa2 627 770 1e-35 SMART
Blast:Int_alpha 639 676 9e-16 BLAST
SCOP:d1m1xa3 773 948 7e-42 SMART
transmembrane domain 978 1000 N/A INTRINSIC
PDB:4HKC|B 1003 1032 1e-13 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000099974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143602
Predicted Effect probably benign
Transcript: ENSMUST00000143974
AA Change: I449T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114325
Gene: ENSMUSG00000075256
AA Change: I449T

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 70 80 N/A INTRINSIC
Pfam:DAGK_cat 152 293 2.6e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153602
Predicted Effect probably benign
Transcript: ENSMUST00000156731
AA Change: I31T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.2%
  • 20x: 90.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was initially identified as a locus (RP26) associated with an autosomal recessive form of retinitis pigmentosa (arRP) disease. This gene encodes a protein with ceramide kinase-like domains, however, the protein does not phosphorylate ceramide and its target substrate is currently unknown. This protein may be a negative regulator of apoptosis in photoreceptor cells. Mutations in this gene cause a form of retinitis pigmentosa characterized by autosomal recessive cone and rod dystrophy (arCRD). Alternative splicing of this gene results in multiple transcript variants encoding different isoforms and non-coding transcripts.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit retinal apoptosis and decreased amplitudes and increased implicit time of oscillatory potentials. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T G 3: 60,039,532 I217R probably damaging Het
Acp1 G T 12: 30,905,127 S20* probably null Het
Adcy3 A G 12: 4,198,360 D474G probably benign Het
Apob T C 12: 7,983,941 I217T probably benign Het
Cdh12 G A 15: 21,492,599 V235I probably damaging Het
Cdhr5 T A 7: 141,272,149 T197S probably damaging Het
Cpz A G 5: 35,517,654 Y84H probably damaging Het
Drosha T C 15: 12,842,533 probably null Het
Fbxo11 A T 17: 87,997,603 N613K probably damaging Het
Fes G T 7: 80,381,205 T536K probably damaging Het
Gm13941 G C 2: 111,100,600 T76R unknown Het
Lrp1 T C 10: 127,593,965 E412G probably damaging Het
Map3k12 T C 15: 102,503,852 I285V probably damaging Het
Map3k13 G A 16: 21,926,240 D850N probably damaging Het
Mapk4 C T 18: 73,970,337 V34M probably damaging Het
Morn1 T A 4: 155,087,471 W43R probably damaging Het
Ncan T G 8: 70,108,389 M643L possibly damaging Het
Npc1l1 G A 11: 6,218,239 T984M probably damaging Het
Olfr1441 A G 19: 12,423,235 K309E probably benign Het
Olfr301 A G 7: 86,413,195 T278A probably benign Het
Olfr467 T C 7: 107,815,211 I209T probably benign Het
Olfr987 A G 2: 85,331,932 probably benign Het
Pcdhb22 T C 18: 37,520,014 F255L probably damaging Het
Pi4ka T C 16: 17,285,260 D1697G possibly damaging Het
Pla2g12b A G 10: 59,421,484 D163G probably damaging Het
Pot1a G A 6: 25,756,268 T359M possibly damaging Het
Sass6 G A 3: 116,603,523 probably null Het
Scn1a C T 2: 66,323,307 probably null Het
Slc38a1 A G 15: 96,609,862 L103P probably damaging Het
Slc38a6 T A 12: 73,344,785 probably null Het
Smarca4 C T 9: 21,636,215 P265S probably benign Het
Snrpa1 A G 7: 66,070,615 T189A probably benign Het
Snx11 G A 11: 96,769,278 P195L possibly damaging Het
Spen T G 4: 141,485,564 I584L unknown Het
Sult2a5 T A 7: 13,625,409 H103Q probably benign Het
Syce1 T C 7: 140,780,523 K50E probably damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem132a A G 19: 10,858,113 S1018P probably damaging Het
Other mutations in Cerkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Cerkl APN 2 79341499 missense probably benign 0.00
IGL01330:Cerkl APN 2 79368781 missense possibly damaging 0.90
IGL01468:Cerkl APN 2 79343215 critical splice donor site probably null
IGL01946:Cerkl APN 2 79393020 missense probably benign 0.19
IGL02027:Cerkl APN 2 79341286 unclassified probably benign
IGL02809:Cerkl APN 2 79342202 missense possibly damaging 0.54
IGL03293:Cerkl APN 2 79342375 missense probably damaging 0.98
R0076:Cerkl UTSW 2 79343289 missense possibly damaging 0.93
R0453:Cerkl UTSW 2 79342451 missense probably benign 0.25
R1533:Cerkl UTSW 2 79341357 missense possibly damaging 0.94
R4003:Cerkl UTSW 2 79428794 missense possibly damaging 0.86
R5078:Cerkl UTSW 2 79393008 missense probably benign 0.29
R5093:Cerkl UTSW 2 79333523 missense probably damaging 1.00
R5431:Cerkl UTSW 2 79341335 missense probably damaging 1.00
R5522:Cerkl UTSW 2 79392984 missense probably benign 0.44
R6249:Cerkl UTSW 2 79368778 missense probably damaging 1.00
R7036:Cerkl UTSW 2 79341378 missense probably benign 0.03
R7201:Cerkl UTSW 2 79333590 missense probably benign 0.00
R7326:Cerkl UTSW 2 79332605 missense probably benign 0.37
R7343:Cerkl UTSW 2 79428760 missense probably damaging 1.00
R7833:Cerkl UTSW 2 79341380 missense probably benign 0.01
R7874:Cerkl UTSW 2 79338637 missense probably damaging 1.00
R8190:Cerkl UTSW 2 79333557 missense probably benign 0.17
R8333:Cerkl UTSW 2 79338578 missense possibly damaging 0.65
Z1176:Cerkl UTSW 2 79368765 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCTAATGTGAACCTCTGATGCAGC -3'
(R):5'- CCTGGGAAAACCATGTTTGATTGCC -3'

Sequencing Primer
(F):5'- GATGCAGCTTCCATTAAGTCAC -3'
(R):5'- ATTCCAAGGGTGAAACTTGTGC -3'
Posted On2013-11-07