Incidental Mutation 'R0918:Gm13941'
ID81525
Institutional Source Beutler Lab
Gene Symbol Gm13941
Ensembl Gene ENSMUSG00000079170
Gene Namepredicted gene 13941
Synonyms
MMRRC Submission 039068-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R0918 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location111088372-111105982 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 111100600 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Arginine at position 76 (T76R)
Ref Sequence ENSEMBL: ENSMUSP00000115383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127918]
Predicted Effect unknown
Transcript: ENSMUST00000127918
AA Change: T76R
SMART Domains Protein: ENSMUSP00000115383
Gene: ENSMUSG00000079170
AA Change: T76R

DomainStartEndE-ValueType
low complexity region 225 244 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.2%
  • 20x: 90.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T G 3: 60,039,532 I217R probably damaging Het
Acp1 G T 12: 30,905,127 S20* probably null Het
Adcy3 A G 12: 4,198,360 D474G probably benign Het
Apob T C 12: 7,983,941 I217T probably benign Het
Cdh12 G A 15: 21,492,599 V235I probably damaging Het
Cdhr5 T A 7: 141,272,149 T197S probably damaging Het
Cerkl A G 2: 79,333,629 I449T probably benign Het
Cpz A G 5: 35,517,654 Y84H probably damaging Het
Drosha T C 15: 12,842,533 probably null Het
Fbxo11 A T 17: 87,997,603 N613K probably damaging Het
Fes G T 7: 80,381,205 T536K probably damaging Het
Lrp1 T C 10: 127,593,965 E412G probably damaging Het
Map3k12 T C 15: 102,503,852 I285V probably damaging Het
Map3k13 G A 16: 21,926,240 D850N probably damaging Het
Mapk4 C T 18: 73,970,337 V34M probably damaging Het
Morn1 T A 4: 155,087,471 W43R probably damaging Het
Ncan T G 8: 70,108,389 M643L possibly damaging Het
Npc1l1 G A 11: 6,218,239 T984M probably damaging Het
Olfr1441 A G 19: 12,423,235 K309E probably benign Het
Olfr301 A G 7: 86,413,195 T278A probably benign Het
Olfr467 T C 7: 107,815,211 I209T probably benign Het
Olfr987 A G 2: 85,331,932 probably benign Het
Pcdhb22 T C 18: 37,520,014 F255L probably damaging Het
Pi4ka T C 16: 17,285,260 D1697G possibly damaging Het
Pla2g12b A G 10: 59,421,484 D163G probably damaging Het
Pot1a G A 6: 25,756,268 T359M possibly damaging Het
Sass6 G A 3: 116,603,523 probably null Het
Scn1a C T 2: 66,323,307 probably null Het
Slc38a1 A G 15: 96,609,862 L103P probably damaging Het
Slc38a6 T A 12: 73,344,785 probably null Het
Smarca4 C T 9: 21,636,215 P265S probably benign Het
Snrpa1 A G 7: 66,070,615 T189A probably benign Het
Snx11 G A 11: 96,769,278 P195L possibly damaging Het
Spen T G 4: 141,485,564 I584L unknown Het
Sult2a5 T A 7: 13,625,409 H103Q probably benign Het
Syce1 T C 7: 140,780,523 K50E probably damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem132a A G 19: 10,858,113 S1018P probably damaging Het
Other mutations in Gm13941
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Gm13941 APN 2 111104853 missense unknown
IGL00420:Gm13941 APN 2 111091848 splice site probably benign
IGL01149:Gm13941 APN 2 111101137 missense unknown
IGL01319:Gm13941 APN 2 111094805 critical splice acceptor site probably null
IGL02557:Gm13941 APN 2 111101156 missense unknown
IGL03163:Gm13941 APN 2 111098416 missense unknown
R0067:Gm13941 UTSW 2 111059416 unclassified noncoding transcript
R2315:Gm13941 UTSW 2 111104817 missense unknown
R3847:Gm13941 UTSW 2 111104853 missense unknown
R3848:Gm13941 UTSW 2 111104853 missense unknown
R5416:Gm13941 UTSW 2 111094734 missense unknown
R5574:Gm13941 UTSW 2 111100606 missense unknown
R6389:Gm13941 UTSW 2 111098389 missense unknown
R6616:Gm13941 UTSW 2 111101175 missense unknown
R7056:Gm13941 UTSW 2 111096802 missense unknown
R7455:Gm13941 UTSW 2 111094740 missense unknown
Z1177:Gm13941 UTSW 2 111094778 missense unknown
Predicted Primers PCR Primer
(F):5'- GTTCATCGCTTGATATAACTACCTGCATACT -3'
(R):5'- AGAAGAACTTAGCTTTATCAACAACAATGCAC -3'

Sequencing Primer
(F):5'- GGTACTAACGTCCATGAGCTG -3'
(R):5'- CAACAACAATGCACTGATTTCTTG -3'
Posted On2013-11-07