Incidental Mutation 'R0918:Smarca4'
ID 81545
Institutional Source Beutler Lab
Gene Symbol Smarca4
Ensembl Gene ENSMUSG00000032187
Gene Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
Synonyms SW1/SNF, Brg1, SNF2beta, b2b692Clo, b2b508.1Clo
MMRRC Submission 039068-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0918 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 21527465-21615526 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 21547511 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 265 (P265S)
Ref Sequence ENSEMBL: ENSMUSP00000133922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034707] [ENSMUST00000098948] [ENSMUST00000174008]
AlphaFold Q3TKT4
Predicted Effect probably benign
Transcript: ENSMUST00000034707
AA Change: P265S

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000034707
Gene: ENSMUSG00000032187
AA Change: P265S

DomainStartEndE-ValueType
low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1360 1385 N/A INTRINSIC
low complexity region 1388 1398 N/A INTRINSIC
BROMO 1422 1533 4.19e-42 SMART
low complexity region 1534 1557 N/A INTRINSIC
low complexity region 1578 1588 N/A INTRINSIC
low complexity region 1594 1614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098948
AA Change: P265S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000096547
Gene: ENSMUSG00000032187
AA Change: P265S

DomainStartEndE-ValueType
low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1363 1388 N/A INTRINSIC
low complexity region 1391 1401 N/A INTRINSIC
BROMO 1425 1536 4.19e-42 SMART
low complexity region 1537 1560 N/A INTRINSIC
low complexity region 1581 1591 N/A INTRINSIC
low complexity region 1597 1617 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000172996
AA Change: P69S
SMART Domains Protein: ENSMUSP00000133535
Gene: ENSMUSG00000032187
AA Change: P69S

DomainStartEndE-ValueType
low complexity region 26 52 N/A INTRINSIC
low complexity region 57 94 N/A INTRINSIC
low complexity region 109 135 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
HSA 265 337 2e-27 SMART
coiled coil region 367 399 N/A INTRINSIC
BRK 417 461 5.17e-21 SMART
low complexity region 462 477 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
DEXDc 555 747 5.17e-38 SMART
Blast:DEXDc 758 790 6e-10 BLAST
low complexity region 824 839 N/A INTRINSIC
HELICc 915 999 7.27e-24 SMART
low complexity region 1088 1105 N/A INTRINSIC
SnAC 1126 1194 2.8e-29 SMART
low complexity region 1201 1226 N/A INTRINSIC
low complexity region 1229 1239 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174008
AA Change: P265S

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133922
Gene: ENSMUSG00000032187
AA Change: P265S

DomainStartEndE-ValueType
low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1360 1385 N/A INTRINSIC
low complexity region 1388 1398 N/A INTRINSIC
BROMO 1422 1532 1.36e-41 SMART
low complexity region 1533 1556 N/A INTRINSIC
low complexity region 1577 1587 N/A INTRINSIC
low complexity region 1593 1613 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.2%
  • 20x: 90.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. In addition, this protein can bind BRCA1, as well as regulate the expression of the tumorigenic protein CD44. Mutations in this gene cause rhabdoid tumor predisposition syndrome type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a null allele die in utero before implantation. Embryos heterozygous for this null allele and an ENU-induced allele show impaired definitive erythropoiesis, anemia and lethality during organogenesis. Heterozygotes for a different null allele show cyanosis and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T G 3: 59,946,953 (GRCm39) I217R probably damaging Het
Acp1 G T 12: 30,955,126 (GRCm39) S20* probably null Het
Adcy3 A G 12: 4,248,360 (GRCm39) D474G probably benign Het
Apob T C 12: 8,033,941 (GRCm39) I217T probably benign Het
Cdh12 G A 15: 21,492,685 (GRCm39) V235I probably damaging Het
Cdhr5 T A 7: 140,852,062 (GRCm39) T197S probably damaging Het
Cerkl A G 2: 79,163,973 (GRCm39) I449T probably benign Het
Cpz A G 5: 35,674,998 (GRCm39) Y84H probably damaging Het
Drosha T C 15: 12,842,619 (GRCm39) probably null Het
Fbxo11 A T 17: 88,305,031 (GRCm39) N613K probably damaging Het
Fes G T 7: 80,030,953 (GRCm39) T536K probably damaging Het
Gm13941 G C 2: 110,930,945 (GRCm39) T76R unknown Het
Lrp1 T C 10: 127,429,834 (GRCm39) E412G probably damaging Het
Map3k12 T C 15: 102,412,287 (GRCm39) I285V probably damaging Het
Map3k13 G A 16: 21,744,990 (GRCm39) D850N probably damaging Het
Mapk4 C T 18: 74,103,408 (GRCm39) V34M probably damaging Het
Morn1 T A 4: 155,171,928 (GRCm39) W43R probably damaging Het
Ncan T G 8: 70,561,039 (GRCm39) M643L possibly damaging Het
Npc1l1 G A 11: 6,168,239 (GRCm39) T984M probably damaging Het
Or14c44 A G 7: 86,062,403 (GRCm39) T278A probably benign Het
Or5a3 A G 19: 12,400,599 (GRCm39) K309E probably benign Het
Or5ak4 A G 2: 85,162,276 (GRCm39) probably benign Het
Or5p5 T C 7: 107,414,418 (GRCm39) I209T probably benign Het
Pcdhb22 T C 18: 37,653,067 (GRCm39) F255L probably damaging Het
Pi4ka T C 16: 17,103,124 (GRCm39) D1697G possibly damaging Het
Pla2g12b A G 10: 59,257,306 (GRCm39) D163G probably damaging Het
Pot1a G A 6: 25,756,267 (GRCm39) T359M possibly damaging Het
Sass6 G A 3: 116,397,172 (GRCm39) probably null Het
Scn1a C T 2: 66,153,651 (GRCm39) probably null Het
Slc38a1 A G 15: 96,507,743 (GRCm39) L103P probably damaging Het
Slc38a6 T A 12: 73,391,559 (GRCm39) probably null Het
Snrpa1 A G 7: 65,720,363 (GRCm39) T189A probably benign Het
Snx11 G A 11: 96,660,104 (GRCm39) P195L possibly damaging Het
Spen T G 4: 141,212,875 (GRCm39) I584L unknown Het
Sult2a5 T A 7: 13,359,334 (GRCm39) H103Q probably benign Het
Syce1 T C 7: 140,360,436 (GRCm39) K50E probably damaging Het
Timm21 G C 18: 84,967,387 (GRCm39) L130V probably damaging Het
Tmem132a A G 19: 10,835,477 (GRCm39) S1018P probably damaging Het
Other mutations in Smarca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Smarca4 APN 9 21,590,369 (GRCm39) missense probably benign 0.30
IGL01694:Smarca4 APN 9 21,577,166 (GRCm39) missense probably damaging 1.00
IGL02147:Smarca4 APN 9 21,546,999 (GRCm39) missense probably damaging 0.98
IGL02417:Smarca4 APN 9 21,612,386 (GRCm39) missense probably damaging 1.00
IGL02421:Smarca4 APN 9 21,550,535 (GRCm39) missense probably damaging 1.00
IGL02550:Smarca4 APN 9 21,597,418 (GRCm39) missense probably benign 0.25
IGL02794:Smarca4 APN 9 21,584,638 (GRCm39) splice site probably benign
IGL03030:Smarca4 APN 9 21,547,132 (GRCm39) missense probably benign 0.14
IGL03037:Smarca4 APN 9 21,544,231 (GRCm39) unclassified probably benign
IGL03069:Smarca4 APN 9 21,547,132 (GRCm39) missense probably benign 0.14
IGL03355:Smarca4 APN 9 21,547,132 (GRCm39) missense probably benign 0.14
R0123:Smarca4 UTSW 9 21,548,620 (GRCm39) missense probably damaging 1.00
R0134:Smarca4 UTSW 9 21,548,620 (GRCm39) missense probably damaging 1.00
R0230:Smarca4 UTSW 9 21,612,168 (GRCm39) missense probably damaging 0.99
R0269:Smarca4 UTSW 9 21,547,497 (GRCm39) missense probably benign 0.09
R0631:Smarca4 UTSW 9 21,570,280 (GRCm39) splice site probably benign
R0665:Smarca4 UTSW 9 21,612,239 (GRCm39) small deletion probably benign
R0726:Smarca4 UTSW 9 21,611,435 (GRCm39) critical splice donor site probably null
R0801:Smarca4 UTSW 9 21,553,850 (GRCm39) missense possibly damaging 0.81
R1411:Smarca4 UTSW 9 21,570,251 (GRCm39) missense probably damaging 1.00
R1604:Smarca4 UTSW 9 21,612,239 (GRCm39) small deletion probably benign
R1768:Smarca4 UTSW 9 21,612,479 (GRCm39) missense possibly damaging 0.56
R2004:Smarca4 UTSW 9 21,588,776 (GRCm39) missense probably damaging 1.00
R2031:Smarca4 UTSW 9 21,597,358 (GRCm39) missense possibly damaging 0.68
R2211:Smarca4 UTSW 9 21,597,325 (GRCm39) missense probably damaging 1.00
R2512:Smarca4 UTSW 9 21,546,994 (GRCm39) missense possibly damaging 0.95
R2875:Smarca4 UTSW 9 21,553,876 (GRCm39) missense possibly damaging 0.55
R3786:Smarca4 UTSW 9 21,583,355 (GRCm39) missense possibly damaging 0.94
R4829:Smarca4 UTSW 9 21,550,623 (GRCm39) missense probably damaging 0.97
R5084:Smarca4 UTSW 9 21,572,059 (GRCm39) missense probably damaging 1.00
R5222:Smarca4 UTSW 9 21,567,002 (GRCm39) missense probably benign 0.01
R5785:Smarca4 UTSW 9 21,597,322 (GRCm39) missense probably damaging 0.99
R5844:Smarca4 UTSW 9 21,589,238 (GRCm39) intron probably benign
R5964:Smarca4 UTSW 9 21,558,726 (GRCm39) missense probably benign 0.00
R6001:Smarca4 UTSW 9 21,544,205 (GRCm39) unclassified probably benign
R6072:Smarca4 UTSW 9 21,611,417 (GRCm39) missense probably damaging 1.00
R6254:Smarca4 UTSW 9 21,611,173 (GRCm39) missense probably damaging 1.00
R6320:Smarca4 UTSW 9 21,548,671 (GRCm39) missense probably damaging 1.00
R6353:Smarca4 UTSW 9 21,590,445 (GRCm39) critical splice donor site probably null
R6461:Smarca4 UTSW 9 21,590,316 (GRCm39) missense probably damaging 1.00
R6886:Smarca4 UTSW 9 21,570,127 (GRCm39) missense probably damaging 1.00
R7098:Smarca4 UTSW 9 21,546,116 (GRCm39) missense probably benign 0.10
R7253:Smarca4 UTSW 9 21,570,256 (GRCm39) missense probably benign 0.01
R7307:Smarca4 UTSW 9 21,550,096 (GRCm39) missense probably damaging 1.00
R7382:Smarca4 UTSW 9 21,570,229 (GRCm39) missense probably damaging 0.98
R7445:Smarca4 UTSW 9 21,597,543 (GRCm39) missense probably damaging 1.00
R7535:Smarca4 UTSW 9 21,558,921 (GRCm39) missense possibly damaging 0.82
R7573:Smarca4 UTSW 9 21,550,371 (GRCm39) splice site probably null
R7644:Smarca4 UTSW 9 21,566,950 (GRCm39) missense probably benign 0.00
R7734:Smarca4 UTSW 9 21,578,658 (GRCm39) missense possibly damaging 0.65
R7833:Smarca4 UTSW 9 21,558,655 (GRCm39) missense possibly damaging 0.86
R8085:Smarca4 UTSW 9 21,570,108 (GRCm39) splice site probably null
R8119:Smarca4 UTSW 9 21,558,922 (GRCm39) missense possibly damaging 0.61
R8320:Smarca4 UTSW 9 21,588,798 (GRCm39) missense probably benign 0.10
R8445:Smarca4 UTSW 9 21,612,239 (GRCm39) small deletion probably benign
R8493:Smarca4 UTSW 9 21,570,144 (GRCm39) missense probably damaging 1.00
R8748:Smarca4 UTSW 9 21,546,164 (GRCm39) missense possibly damaging 0.85
R8788:Smarca4 UTSW 9 21,550,024 (GRCm39) missense probably damaging 1.00
R8817:Smarca4 UTSW 9 21,547,497 (GRCm39) missense probably benign 0.04
R9241:Smarca4 UTSW 9 21,550,604 (GRCm39) missense possibly damaging 0.72
R9446:Smarca4 UTSW 9 21,547,155 (GRCm39) missense unknown
R9570:Smarca4 UTSW 9 21,580,849 (GRCm39) missense probably damaging 1.00
R9727:Smarca4 UTSW 9 21,611,160 (GRCm39) missense probably damaging 1.00
R9801:Smarca4 UTSW 9 21,586,397 (GRCm39) missense probably damaging 1.00
Z1176:Smarca4 UTSW 9 21,614,253 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATAATGACAGGCAACCCTGACTCC -3'
(R):5'- AGTTGAACCCCTAGAGAGGTCCAC -3'

Sequencing Primer
(F):5'- CCTGAGCTGATGTGAGCATAG -3'
(R):5'- TCCACAGAAAACAAGGTTTCTGG -3'
Posted On 2013-11-07