Incidental Mutation 'R0918:Pla2g12b'
ID 81546
Institutional Source Beutler Lab
Gene Symbol Pla2g12b
Ensembl Gene ENSMUSG00000009646
Gene Name phospholipase A2, group XIIB
Synonyms 2010002E04Rik, hlb218, Pla2g13
MMRRC Submission 039068-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.812) question?
Stock # R0918 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 59403660-59421976 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59421484 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 163 (D163G)
Ref Sequence ENSEMBL: ENSMUSP00000009790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009790] [ENSMUST00000009798] [ENSMUST00000162643]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000009790
AA Change: D163G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000009790
Gene: ENSMUSG00000009646
AA Change: D163G

DomainStartEndE-ValueType
Pfam:PLA2G12 12 195 1.5e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000009798
SMART Domains Protein: ENSMUSP00000009798
Gene: ENSMUSG00000009654

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:ZP 50 144 9e-24 BLAST
EGF 150 181 2.16e1 SMART
EGF 185 222 2.94e-3 SMART
EGF 226 263 2.35e-2 SMART
ZP 267 516 2.74e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162643
SMART Domains Protein: ENSMUSP00000123842
Gene: ENSMUSG00000009646

DomainStartEndE-ValueType
Pfam:PLA2G12 1 77 1.7e-36 PFAM
low complexity region 90 101 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.2%
  • 20x: 90.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phospholipase A2 (PLA2) group of enzymes, which function in glycolipid hydrolysis with the release of free fatty acids and lysophospholipids. This family member has altered phospholipid-binding properties and is catalytically inactive. The protein is secreted, and together with microsomal triglyceride transfer protein, it functions to regulate HNF4alpha-induced hepatitis C virus infectivity. The expression of this gene is down-regulated in various tumors, suggesting that it may function as a negative regulator of tumor progression. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit a reduction in serum total and HDL cholesterol levels, decreased serum triglyceride levels, and hepatic steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T G 3: 60,039,532 I217R probably damaging Het
Acp1 G T 12: 30,905,127 S20* probably null Het
Adcy3 A G 12: 4,198,360 D474G probably benign Het
Apob T C 12: 7,983,941 I217T probably benign Het
Cdh12 G A 15: 21,492,599 V235I probably damaging Het
Cdhr5 T A 7: 141,272,149 T197S probably damaging Het
Cerkl A G 2: 79,333,629 I449T probably benign Het
Cpz A G 5: 35,517,654 Y84H probably damaging Het
Drosha T C 15: 12,842,533 probably null Het
Fbxo11 A T 17: 87,997,603 N613K probably damaging Het
Fes G T 7: 80,381,205 T536K probably damaging Het
Gm13941 G C 2: 111,100,600 T76R unknown Het
Lrp1 T C 10: 127,593,965 E412G probably damaging Het
Map3k12 T C 15: 102,503,852 I285V probably damaging Het
Map3k13 G A 16: 21,926,240 D850N probably damaging Het
Mapk4 C T 18: 73,970,337 V34M probably damaging Het
Morn1 T A 4: 155,087,471 W43R probably damaging Het
Ncan T G 8: 70,108,389 M643L possibly damaging Het
Npc1l1 G A 11: 6,218,239 T984M probably damaging Het
Olfr1441 A G 19: 12,423,235 K309E probably benign Het
Olfr301 A G 7: 86,413,195 T278A probably benign Het
Olfr467 T C 7: 107,815,211 I209T probably benign Het
Olfr987 A G 2: 85,331,932 probably benign Het
Pcdhb22 T C 18: 37,520,014 F255L probably damaging Het
Pi4ka T C 16: 17,285,260 D1697G possibly damaging Het
Pot1a G A 6: 25,756,268 T359M possibly damaging Het
Sass6 G A 3: 116,603,523 probably null Het
Scn1a C T 2: 66,323,307 probably null Het
Slc38a1 A G 15: 96,609,862 L103P probably damaging Het
Slc38a6 T A 12: 73,344,785 probably null Het
Smarca4 C T 9: 21,636,215 P265S probably benign Het
Snrpa1 A G 7: 66,070,615 T189A probably benign Het
Snx11 G A 11: 96,769,278 P195L possibly damaging Het
Spen T G 4: 141,485,564 I584L unknown Het
Sult2a5 T A 7: 13,625,409 H103Q probably benign Het
Syce1 T C 7: 140,780,523 K50E probably damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem132a A G 19: 10,858,113 S1018P probably damaging Het
Other mutations in Pla2g12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Pla2g12b APN 10 59416417 missense probably benign 0.28
IGL02526:Pla2g12b APN 10 59416453 missense probably damaging 1.00
IGL02551:Pla2g12b APN 10 59403870 missense probably damaging 1.00
florissant UTSW 10 59421441 unclassified probably benign
R0800:Pla2g12b UTSW 10 59403820 missense probably benign 0.00
R1412:Pla2g12b UTSW 10 59403982 critical splice donor site probably null
R1602:Pla2g12b UTSW 10 59421553 splice site probably null
R3765:Pla2g12b UTSW 10 59421501 missense probably damaging 1.00
R4822:Pla2g12b UTSW 10 59416514 critical splice donor site probably null
R5963:Pla2g12b UTSW 10 59403958 missense probably damaging 1.00
R6140:Pla2g12b UTSW 10 59421441 unclassified probably benign
R7889:Pla2g12b UTSW 10 59421240 splice site probably null
R7897:Pla2g12b UTSW 10 59410994 nonsense probably null
R8075:Pla2g12b UTSW 10 59421452 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCTGGAGGTGCCACAAAACTGAG -3'
(R):5'- GAAGAAAGGACGGCTCTCTTGTCAC -3'

Sequencing Primer
(F):5'- ATGCCAGCAAGTGTATCTGC -3'
(R):5'- GGCTCTCTTGTCACACAGC -3'
Posted On 2013-11-07