Incidental Mutation 'R0918:Npc1l1'
ID81548
Institutional Source Beutler Lab
Gene Symbol Npc1l1
Ensembl Gene ENSMUSG00000020447
Gene NameNPC1 like intracellular cholesterol transporter 1
Synonyms9130221N23Rik, Niemann-Pick disease, type C1
MMRRC Submission 039068-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R0918 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location6211013-6230143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 6218239 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 984 (T984M)
Ref Sequence ENSEMBL: ENSMUSP00000004505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004505]
Predicted Effect probably damaging
Transcript: ENSMUST00000004505
AA Change: T984M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004505
Gene: ENSMUSG00000020447
AA Change: T984M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:NPC1_N 28 283 8.7e-74 PFAM
low complexity region 294 307 N/A INTRINSIC
transmembrane domain 348 370 N/A INTRINSIC
Pfam:Patched 385 897 4.7e-52 PFAM
Pfam:Sterol-sensing 661 815 5.7e-55 PFAM
Pfam:MMPL 665 830 2.3e-11 PFAM
Pfam:Patched 1063 1268 6.2e-34 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.2%
  • 20x: 90.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a multi-pass membrane protein. It contains a conserved N-terminal Niemann-Pick C1 (NPC1) domain and a putative sterol-sensing domain (SSD) which includes a YQRL motif functioning as a plasma membrane to trans-Golgi network transport signal in other proteins. This protein takes up free cholesterol into cells through vesicular endocytosis and plays a critical role in the absorption of intestinal cholesterol. It also has the ability to transport alpha-tocopherol (vitamin E). The drug ezetimibe targets this protein and inhibits the absorption of intestinal cholesterol and alpha-tocopherol. In addition, this protein may play a critical role in regulating lipid metabolism. Polymorphic variations in this gene are associated with plasma total cholesterol and low-density lipoprotein cholesterol (LDL-C) levels and coronary heart disease (CHD) risk. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit normal intestinal development, fertility and plasma cholesterol and triglyceride levels; however, intestinal cholesterol absorption was substantially reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T G 3: 60,039,532 I217R probably damaging Het
Acp1 G T 12: 30,905,127 S20* probably null Het
Adcy3 A G 12: 4,198,360 D474G probably benign Het
Apob T C 12: 7,983,941 I217T probably benign Het
Cdh12 G A 15: 21,492,599 V235I probably damaging Het
Cdhr5 T A 7: 141,272,149 T197S probably damaging Het
Cerkl A G 2: 79,333,629 I449T probably benign Het
Cpz A G 5: 35,517,654 Y84H probably damaging Het
Drosha T C 15: 12,842,533 probably null Het
Fbxo11 A T 17: 87,997,603 N613K probably damaging Het
Fes G T 7: 80,381,205 T536K probably damaging Het
Gm13941 G C 2: 111,100,600 T76R unknown Het
Lrp1 T C 10: 127,593,965 E412G probably damaging Het
Map3k12 T C 15: 102,503,852 I285V probably damaging Het
Map3k13 G A 16: 21,926,240 D850N probably damaging Het
Mapk4 C T 18: 73,970,337 V34M probably damaging Het
Morn1 T A 4: 155,087,471 W43R probably damaging Het
Ncan T G 8: 70,108,389 M643L possibly damaging Het
Olfr1441 A G 19: 12,423,235 K309E probably benign Het
Olfr301 A G 7: 86,413,195 T278A probably benign Het
Olfr467 T C 7: 107,815,211 I209T probably benign Het
Olfr987 A G 2: 85,331,932 probably benign Het
Pcdhb22 T C 18: 37,520,014 F255L probably damaging Het
Pi4ka T C 16: 17,285,260 D1697G possibly damaging Het
Pla2g12b A G 10: 59,421,484 D163G probably damaging Het
Pot1a G A 6: 25,756,268 T359M possibly damaging Het
Sass6 G A 3: 116,603,523 probably null Het
Scn1a C T 2: 66,323,307 probably null Het
Slc38a1 A G 15: 96,609,862 L103P probably damaging Het
Slc38a6 T A 12: 73,344,785 probably null Het
Smarca4 C T 9: 21,636,215 P265S probably benign Het
Snrpa1 A G 7: 66,070,615 T189A probably benign Het
Snx11 G A 11: 96,769,278 P195L possibly damaging Het
Spen T G 4: 141,485,564 I584L unknown Het
Sult2a5 T A 7: 13,625,409 H103Q probably benign Het
Syce1 T C 7: 140,780,523 K50E probably damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem132a A G 19: 10,858,113 S1018P probably damaging Het
Other mutations in Npc1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Npc1l1 APN 11 6224199 missense probably damaging 1.00
IGL01348:Npc1l1 APN 11 6227974 missense probably damaging 1.00
IGL01891:Npc1l1 APN 11 6214280 missense probably damaging 1.00
IGL01897:Npc1l1 APN 11 6227879 missense probably benign
IGL02098:Npc1l1 APN 11 6214581 missense probably damaging 0.99
IGL02121:Npc1l1 APN 11 6228157 missense probably benign
IGL02724:Npc1l1 APN 11 6214684 missense possibly damaging 0.88
IGL02947:Npc1l1 APN 11 6229246 missense probably benign 0.01
IGL03328:Npc1l1 APN 11 6218643 nonsense probably null
R0137:Npc1l1 UTSW 11 6228148 nonsense probably null
R0322:Npc1l1 UTSW 11 6229042 missense probably benign
R0352:Npc1l1 UTSW 11 6223076 missense probably benign 0.00
R0492:Npc1l1 UTSW 11 6223040 missense possibly damaging 0.82
R1300:Npc1l1 UTSW 11 6227859 missense probably damaging 1.00
R1455:Npc1l1 UTSW 11 6228174 missense possibly damaging 0.66
R1588:Npc1l1 UTSW 11 6217785 missense probably benign 0.01
R1803:Npc1l1 UTSW 11 6228846 missense probably damaging 1.00
R1882:Npc1l1 UTSW 11 6217473 splice site probably null
R1944:Npc1l1 UTSW 11 6214588 missense possibly damaging 0.67
R1945:Npc1l1 UTSW 11 6214588 missense possibly damaging 0.67
R1945:Npc1l1 UTSW 11 6225199 nonsense probably null
R3155:Npc1l1 UTSW 11 6221840 missense probably benign
R4343:Npc1l1 UTSW 11 6217773 missense probably benign
R4504:Npc1l1 UTSW 11 6228741 missense possibly damaging 0.61
R4610:Npc1l1 UTSW 11 6228215 missense probably damaging 1.00
R4807:Npc1l1 UTSW 11 6218723 missense probably damaging 1.00
R4829:Npc1l1 UTSW 11 6214010 critical splice donor site probably null
R5135:Npc1l1 UTSW 11 6224245 missense possibly damaging 0.94
R5290:Npc1l1 UTSW 11 6222221 missense probably benign 0.00
R5369:Npc1l1 UTSW 11 6217705 critical splice donor site probably null
R5388:Npc1l1 UTSW 11 6214733 missense probably damaging 1.00
R5532:Npc1l1 UTSW 11 6224245 missense probably damaging 0.98
R5540:Npc1l1 UTSW 11 6214546 missense probably damaging 1.00
R5754:Npc1l1 UTSW 11 6227839 missense probably damaging 1.00
R5760:Npc1l1 UTSW 11 6229031 missense probably benign 0.02
R6057:Npc1l1 UTSW 11 6217806 missense possibly damaging 0.66
R6388:Npc1l1 UTSW 11 6224145 missense probably damaging 1.00
R6644:Npc1l1 UTSW 11 6214013 missense probably damaging 1.00
R6644:Npc1l1 UTSW 11 6214014 missense probably damaging 0.98
R6756:Npc1l1 UTSW 11 6215153 missense probably damaging 1.00
R6790:Npc1l1 UTSW 11 6214260 splice site probably null
R7006:Npc1l1 UTSW 11 6217731 missense probably benign
R7062:Npc1l1 UTSW 11 6217807 missense probably benign
R7273:Npc1l1 UTSW 11 6218320 missense probably damaging 1.00
R7383:Npc1l1 UTSW 11 6217777 missense probably benign 0.30
X0022:Npc1l1 UTSW 11 6228058 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGGGGACACTGATAGTGTGAG -3'
(R):5'- ACAACTTTTCCACCGAGGCAGG -3'

Sequencing Primer
(F):5'- ACTGATAGTGTGAGTGCCTAACC -3'
(R):5'- CAGGCATGAACGCCATTTG -3'
Posted On2013-11-07