Incidental Mutation 'R0918:Drosha'
ID81556
Institutional Source Beutler Lab
Gene Symbol Drosha
Ensembl Gene ENSMUSG00000022191
Gene Namedrosha, ribonuclease type III
Synonyms1110013A17Rik, Rnasen, Etohi2
MMRRC Submission 039068-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R0918 (G1)
Quality Score214
Status Not validated
Chromosome15
Chromosomal Location12824815-12935291 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 12842533 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090292] [ENSMUST00000169061]
Predicted Effect probably null
Transcript: ENSMUST00000090292
SMART Domains Protein: ENSMUSP00000087762
Gene: ENSMUSG00000022191

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
low complexity region 43 69 N/A INTRINSIC
low complexity region 72 102 N/A INTRINSIC
low complexity region 109 137 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 227 269 N/A INTRINSIC
low complexity region 273 301 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
low complexity region 387 410 N/A INTRINSIC
low complexity region 472 499 N/A INTRINSIC
SCOP:d1jfza_ 878 902 4e-4 SMART
RIBOc 942 1076 1.73e-45 SMART
Blast:RIBOc 1086 1112 1e-6 BLAST
RIBOc 1121 1253 1.6e-49 SMART
DSRM 1260 1332 5.75e-20 SMART
coiled coil region 1346 1370 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000129031
SMART Domains Protein: ENSMUSP00000121499
Gene: ENSMUSG00000022191

DomainStartEndE-ValueType
low complexity region 115 142 N/A INTRINSIC
SCOP:d1jfza_ 521 545 6e-4 SMART
RIBOc 585 719 1.73e-45 SMART
Blast:RIBOc 729 755 1e-6 BLAST
RIBOc 764 896 1.6e-49 SMART
DSRM 903 975 5.75e-20 SMART
coiled coil region 988 1012 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150211
Predicted Effect probably null
Transcript: ENSMUST00000169061
SMART Domains Protein: ENSMUSP00000129279
Gene: ENSMUSG00000022191

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
low complexity region 43 69 N/A INTRINSIC
low complexity region 72 102 N/A INTRINSIC
low complexity region 109 137 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 227 269 N/A INTRINSIC
low complexity region 273 301 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
low complexity region 387 410 N/A INTRINSIC
low complexity region 472 499 N/A INTRINSIC
SCOP:d1jfza_ 878 902 4e-4 SMART
RIBOc 942 1076 1.73e-45 SMART
Blast:RIBOc 1086 1112 1e-6 BLAST
RIBOc 1121 1253 1.6e-49 SMART
DSRM 1260 1332 5.75e-20 SMART
coiled coil region 1346 1370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198820
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.2%
  • 20x: 90.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ribonuclease (RNase) III double-stranded RNA-specific ribonuclease and subunit of the microprocessor protein complex, which catalyzes the initial processing step of microRNA (miRNA) synthesis. The encoded protein cleaves the stem loop structure from the primary microRNA (pri-miRNA) in the nucleus, yielding the precursor miRNA (pre-miRNA), which is then exported to the cytoplasm for further processing. In a human cell line lacking a functional copy of this gene, canonical miRNA synthesis is reduced. Somatic mutations in this gene have been observed in human patients with kidney cancer. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice heterozygous for a knock-out allele and a conditional allele activated in the immune system exhibit increased inflammation in multiple systems, cachexia and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T G 3: 60,039,532 I217R probably damaging Het
Acp1 G T 12: 30,905,127 S20* probably null Het
Adcy3 A G 12: 4,198,360 D474G probably benign Het
Apob T C 12: 7,983,941 I217T probably benign Het
Cdh12 G A 15: 21,492,599 V235I probably damaging Het
Cdhr5 T A 7: 141,272,149 T197S probably damaging Het
Cerkl A G 2: 79,333,629 I449T probably benign Het
Cpz A G 5: 35,517,654 Y84H probably damaging Het
Fbxo11 A T 17: 87,997,603 N613K probably damaging Het
Fes G T 7: 80,381,205 T536K probably damaging Het
Gm13941 G C 2: 111,100,600 T76R unknown Het
Lrp1 T C 10: 127,593,965 E412G probably damaging Het
Map3k12 T C 15: 102,503,852 I285V probably damaging Het
Map3k13 G A 16: 21,926,240 D850N probably damaging Het
Mapk4 C T 18: 73,970,337 V34M probably damaging Het
Morn1 T A 4: 155,087,471 W43R probably damaging Het
Ncan T G 8: 70,108,389 M643L possibly damaging Het
Npc1l1 G A 11: 6,218,239 T984M probably damaging Het
Olfr1441 A G 19: 12,423,235 K309E probably benign Het
Olfr301 A G 7: 86,413,195 T278A probably benign Het
Olfr467 T C 7: 107,815,211 I209T probably benign Het
Olfr987 A G 2: 85,331,932 probably benign Het
Pcdhb22 T C 18: 37,520,014 F255L probably damaging Het
Pi4ka T C 16: 17,285,260 D1697G possibly damaging Het
Pla2g12b A G 10: 59,421,484 D163G probably damaging Het
Pot1a G A 6: 25,756,268 T359M possibly damaging Het
Sass6 G A 3: 116,603,523 probably null Het
Scn1a C T 2: 66,323,307 probably null Het
Slc38a1 A G 15: 96,609,862 L103P probably damaging Het
Slc38a6 T A 12: 73,344,785 probably null Het
Smarca4 C T 9: 21,636,215 P265S probably benign Het
Snrpa1 A G 7: 66,070,615 T189A probably benign Het
Snx11 G A 11: 96,769,278 P195L possibly damaging Het
Spen T G 4: 141,485,564 I584L unknown Het
Sult2a5 T A 7: 13,625,409 H103Q probably benign Het
Syce1 T C 7: 140,780,523 K50E probably damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem132a A G 19: 10,858,113 S1018P probably damaging Het
Other mutations in Drosha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Drosha APN 15 12883194 missense probably damaging 0.99
IGL00736:Drosha APN 15 12833959 missense unknown
IGL00963:Drosha APN 15 12925997 missense probably damaging 0.99
IGL01010:Drosha APN 15 12827289 unclassified probably benign
IGL01340:Drosha APN 15 12834023 intron probably benign
IGL01481:Drosha APN 15 12842439 missense probably benign
IGL01714:Drosha APN 15 12878784 missense probably damaging 1.00
IGL01721:Drosha APN 15 12846112 nonsense probably null
IGL01765:Drosha APN 15 12902680 missense probably damaging 1.00
IGL01893:Drosha APN 15 12866650 splice site probably benign
IGL01944:Drosha APN 15 12889719 missense probably damaging 1.00
IGL02285:Drosha APN 15 12833864 missense unknown
IGL02970:Drosha APN 15 12913956 missense probably damaging 0.98
IGL02990:Drosha APN 15 12827267 unclassified probably benign
IGL03019:Drosha APN 15 12846099 missense probably damaging 1.00
IGL03279:Drosha APN 15 12859392 missense probably benign 0.03
IGL03390:Drosha APN 15 12884983 splice site probably null
tippicanoe UTSW 15 12859465 splice site probably null
Tyler UTSW 15 12861706 missense probably benign 0.45
R0115:Drosha UTSW 15 12846130 missense probably benign 0.15
R0352:Drosha UTSW 15 12837288 missense unknown
R0401:Drosha UTSW 15 12926031 nonsense probably null
R0541:Drosha UTSW 15 12907388 missense probably benign 0.09
R0784:Drosha UTSW 15 12867678 splice site probably benign
R1473:Drosha UTSW 15 12912520 missense probably benign 0.04
R1503:Drosha UTSW 15 12848073 missense probably benign 0.02
R1526:Drosha UTSW 15 12913984 missense probably damaging 1.00
R1809:Drosha UTSW 15 12890112 missense probably null 1.00
R1859:Drosha UTSW 15 12878718 missense probably benign 0.14
R2004:Drosha UTSW 15 12915381 missense probably damaging 0.98
R2060:Drosha UTSW 15 12924159 missense possibly damaging 0.94
R2516:Drosha UTSW 15 12859465 splice site probably null
R3691:Drosha UTSW 15 12834638 missense unknown
R3784:Drosha UTSW 15 12890529 missense possibly damaging 0.82
R3789:Drosha UTSW 15 12912537 nonsense probably null
R3790:Drosha UTSW 15 12912537 nonsense probably null
R4020:Drosha UTSW 15 12837336 missense possibly damaging 0.96
R4817:Drosha UTSW 15 12914047 missense probably damaging 0.97
R4989:Drosha UTSW 15 12935007 missense probably benign 0.05
R5080:Drosha UTSW 15 12842143 missense probably benign 0.01
R5132:Drosha UTSW 15 12837291 missense unknown
R5215:Drosha UTSW 15 12885133 intron probably benign
R5386:Drosha UTSW 15 12842121 missense probably benign
R5457:Drosha UTSW 15 12926029 missense probably benign 0.26
R5536:Drosha UTSW 15 12929711 missense possibly damaging 0.58
R5800:Drosha UTSW 15 12865067 missense probably damaging 1.00
R5800:Drosha UTSW 15 12902647 missense probably damaging 1.00
R5915:Drosha UTSW 15 12935066 missense probably damaging 0.97
R5988:Drosha UTSW 15 12834496 intron probably benign
R6033:Drosha UTSW 15 12925999 missense probably benign 0.25
R6033:Drosha UTSW 15 12925999 missense probably benign 0.25
R6063:Drosha UTSW 15 12834070 intron probably benign
R6391:Drosha UTSW 15 12889717 nonsense probably null
R6492:Drosha UTSW 15 12861706 missense probably benign 0.45
R6799:Drosha UTSW 15 12912537 nonsense probably null
R6870:Drosha UTSW 15 12907393 missense probably benign 0.17
R6920:Drosha UTSW 15 12834310 missense unknown
R7101:Drosha UTSW 15 12865067 missense probably damaging 1.00
R7142:Drosha UTSW 15 12924146 missense possibly damaging 0.70
R7275:Drosha UTSW 15 12846083 missense possibly damaging 0.73
R7337:Drosha UTSW 15 12846199 missense possibly damaging 0.80
R7471:Drosha UTSW 15 12889656 missense probably damaging 1.00
R7538:Drosha UTSW 15 12926243 missense probably damaging 1.00
R7559:Drosha UTSW 15 12842422 missense probably damaging 0.96
R7653:Drosha UTSW 15 12859436 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TGGCAAAGAGAAGAACTACACGTCC -3'
(R):5'- TCTCTGCAACAGTGATTCTCAACTTGG -3'

Sequencing Primer
(F):5'- TACACGTCCATCAAAGAGAAAGAG -3'
(R):5'- tagcctcaccctgcctc -3'
Posted On2013-11-07