Mutagenetix > Incidental Mutation

Incidental Mutation 'R0964:Sdk2'

81587

Institutional Source

Beutler Lab

Gene Symbol

Sdk2

Ensembl Gene

ENSMUSG00000041592

Gene Name

sidekick cell adhesion molecule 2

Synonyms

5330435L01Rik, 4632412F08Rik

MMRRC Submission

039093-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R0964 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

113776374-114067046 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 113806417 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000038972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041627]

AlphaFold

Q6V4S5

Predicted Effect

probably benign
Transcript: ENSMUST00000041627

SMART Domains

Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGc2	43	102	4.67e-4	SMART
IG	123	208	6.07e-3	SMART
IG	225	309	1.4e-7	SMART
IGc2	325	391	6.21e-9	SMART
IGc2	418	486	8.57e-12	SMART
IG	506	591	2.37e-5	SMART
FN3	594	678	1.91e-7	SMART
FN3	694	780	2.42e-9	SMART
FN3	796	884	3.45e-5	SMART
FN3	899	981	2.36e-12	SMART
FN3	997	1084	1.64e-6	SMART
FN3	1101	1188	8.83e-12	SMART
FN3	1204	1289	3.62e-8	SMART
FN3	1305	1388	1.74e-10	SMART
FN3	1404	1489	8.23e-12	SMART
FN3	1506	1612	3.62e-8	SMART
FN3	1628	1713	1.15e-10	SMART
FN3	1728	1815	2.17e-11	SMART
FN3	1829	1913	5.04e-7	SMART
transmembrane domain	1935	1957	N/A	INTRINSIC
low complexity region	2138	2153	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125879

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156955

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 96.9%
20x: 94.0%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
Acacb	A	T	5: 114,229,752	M1604L	possibly damaging	Het
Acpp	A	G	9: 104,326,975	V40A	possibly damaging	Het
Adgrl1	T	C	8: 83,934,412		probably benign	Het
Alppl2	C	T	1: 87,087,724	V372I	possibly damaging	Het
Apol8	C	T	15: 77,749,611	S255N	probably benign	Het
Atp8b4	A	T	2: 126,337,493	F973I	probably damaging	Het
Bbs4	A	G	9: 59,322,976	*150Q	probably null	Het
Cacna1h	A	T	17: 25,378,775		probably benign	Het
Ccser2	C	T	14: 36,909,008		probably benign	Het
Chd9	A	G	8: 91,015,204	E1607G	probably benign	Het
Clca4b	A	G	3: 144,915,576	I579T	probably benign	Het
Col20a1	T	A	2: 180,984,485		probably benign	Het
Creg2	T	C	1: 39,624,976	I205V	probably benign	Het
Cyr61	C	A	3: 145,647,748	C353F	probably damaging	Het
Ddx24	C	T	12: 103,423,907	R275H	probably damaging	Het
Dip2c	G	A	13: 9,568,663	A579T	probably benign	Het
Dnah3	T	C	7: 119,952,739		probably benign	Het
Dnah8	G	A	17: 30,673,920		probably null	Het
Gckr	T	C	5: 31,326,915		probably benign	Het
Gpbp1l1	A	G	4: 116,581,239		probably benign	Het
Hmcn2	A	G	2: 31,391,511	T1913A	probably benign	Het
Lmo7	T	C	14: 101,920,567		probably benign	Het
Meioc	G	A	11: 102,680,031	V863I	probably damaging	Het
Myh1	A	G	11: 67,221,604	D1799G	probably damaging	Het
Myh1	A	G	11: 67,205,925	I341V	probably benign	Het
Myh13	A	G	11: 67,345,002	T664A	probably benign	Het
Myo3b	A	C	2: 70,426,849	D1269A	probably damaging	Het
Nckap1	A	G	2: 80,547,899		probably null	Het
Nr3c2	A	G	8: 76,908,668		probably null	Het
Nxpe5	T	C	5: 138,239,924	S249P	probably damaging	Het
Olfr1008	A	G	2: 85,690,365	N312S	probably benign	Het
Olfr460	T	C	6: 40,572,205	V273A	probably benign	Het
Olfr67	C	T	7: 103,787,397	M293I	probably benign	Het
Pitpnm3	G	A	11: 72,058,470	T675I	probably damaging	Het
Plekhm1	C	A	11: 103,395,082	E176*	probably null	Het
Prdm11	C	A	2: 92,989,222		probably benign	Het
Prodh2	C	A	7: 30,506,281	R218S	probably damaging	Het
Rps15a	T	C	7: 118,114,837	D54G	probably benign	Het
Sbno2	G	T	10: 80,084,259	T46N	possibly damaging	Het
Sema3c	T	C	5: 17,721,909	F567L	probably damaging	Het
Slc36a1	A	G	11: 55,225,954		probably benign	Het
Spaca6	A	T	17: 17,838,391	E284V	possibly damaging	Het
Srsf3	C	A	17: 29,036,438	L66I	probably damaging	Het
Srsf3	T	A	17: 29,036,439	L66Q	probably damaging	Het
Syne1	T	C	10: 5,043,652	T8363A	possibly damaging	Het
Trmt1	T	A	8: 84,696,852	L298Q	probably damaging	Het
Uba6	T	C	5: 86,119,401	I923V	possibly damaging	Het
Uhrf1bp1	A	T	17: 27,887,178	T893S	probably damaging	Het
Vmn2r106	G	A	17: 20,267,597	H847Y	probably benign	Het
Vmn2r15	T	C	5: 109,297,535	T8A	probably benign	Het
Zbtb39	C	G	10: 127,742,306	Q250E	probably benign	Het
Zbtb41	T	G	1: 139,439,031	F583V	probably damaging	Het
Zfp938	T	A	10: 82,225,419	I456F	probably benign	Het

Other mutations in Sdk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00972:Sdk2	APN	11	113854384	missense	possibly damaging	0.86
IGL01063:Sdk2	APN	11	113830842	missense	probably damaging	1.00
IGL01291:Sdk2	APN	11	113843080	missense	probably benign
IGL01316:Sdk2	APN	11	113867965	missense	probably benign	0.09
IGL01614:Sdk2	APN	11	113793858	missense	probably damaging	1.00
IGL01998:Sdk2	APN	11	113838532	missense	probably damaging	0.98
IGL02014:Sdk2	APN	11	113838494	missense	probably damaging	1.00
IGL02095:Sdk2	APN	11	113834830	missense	probably damaging	1.00
IGL02115:Sdk2	APN	11	113834813	splice site	probably benign
IGL02543:Sdk2	APN	11	113868921	missense	possibly damaging	0.90
IGL02976:Sdk2	APN	11	113851842	missense	probably damaging	1.00
IGL03001:Sdk2	APN	11	113821626	missense	probably benign	0.00
IGL03122:Sdk2	APN	11	113842068	missense	probably damaging	1.00
IGL03183:Sdk2	APN	11	113850984	missense	probably benign	0.19
IGL03222:Sdk2	APN	11	113838431	missense	probably benign	0.01
IGL03310:Sdk2	APN	11	113793325	missense	possibly damaging	0.77
Curtailed	UTSW	11	113851800	missense	probably damaging	1.00
Trimmed	UTSW	11	113856696	nonsense	probably null
ANU05:Sdk2	UTSW	11	113843080	missense	probably benign
BB008:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
BB018:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0088:Sdk2	UTSW	11	113827086	missense	possibly damaging	0.74
R0096:Sdk2	UTSW	11	113903144	splice site	probably benign
R0386:Sdk2	UTSW	11	113893464	missense	probably damaging	0.96
R0396:Sdk2	UTSW	11	113829967	missense	probably benign	0.04
R0409:Sdk2	UTSW	11	113850891	splice site	probably benign
R0416:Sdk2	UTSW	11	113803203	missense	probably damaging	1.00
R0456:Sdk2	UTSW	11	113791466	missense	possibly damaging	0.93
R0544:Sdk2	UTSW	11	113781010	missense	probably damaging	1.00
R0691:Sdk2	UTSW	11	113794920	splice site	probably null
R0711:Sdk2	UTSW	11	113903144	splice site	probably benign
R0717:Sdk2	UTSW	11	113832326	missense	probably damaging	1.00
R0780:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R0831:Sdk2	UTSW	11	113832258	missense	probably damaging	0.96
R0853:Sdk2	UTSW	11	113821415	missense	probably benign	0.00
R0865:Sdk2	UTSW	11	113850922	missense	probably benign	0.12
R0930:Sdk2	UTSW	11	113838445	missense	probably benign	0.01
R1051:Sdk2	UTSW	11	113838646	synonymous	silent
R1052:Sdk2	UTSW	11	113838646	synonymous	silent
R1054:Sdk2	UTSW	11	113838646	synonymous	silent
R1055:Sdk2	UTSW	11	113838646	synonymous	silent
R1077:Sdk2	UTSW	11	113838646	synonymous	silent
R1079:Sdk2	UTSW	11	113838646	synonymous	silent
R1115:Sdk2	UTSW	11	113838646	synonymous	silent
R1186:Sdk2	UTSW	11	113838646	synonymous	silent
R1187:Sdk2	UTSW	11	113838646	synonymous	silent
R1337:Sdk2	UTSW	11	113832331	missense	possibly damaging	0.79
R1430:Sdk2	UTSW	11	113838646	synonymous	silent
R1433:Sdk2	UTSW	11	113795045	missense	probably damaging	0.99
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1497:Sdk2	UTSW	11	113893575	splice site	probably benign
R1514:Sdk2	UTSW	11	113838646	synonymous	silent
R1529:Sdk2	UTSW	11	113838646	synonymous	silent
R1596:Sdk2	UTSW	11	113838609	splice site	probably benign
R1680:Sdk2	UTSW	11	113791436	missense	possibly damaging	0.47
R1680:Sdk2	UTSW	11	113838646	synonymous	silent
R1770:Sdk2	UTSW	11	113793741	missense	probably benign	0.05
R1858:Sdk2	UTSW	11	113838646	synonymous	silent
R1866:Sdk2	UTSW	11	113838646	synonymous	silent
R1874:Sdk2	UTSW	11	113834956	missense	probably benign	0.00
R1899:Sdk2	UTSW	11	113838646	synonymous	silent
R1905:Sdk2	UTSW	11	113838646	synonymous	silent
R1907:Sdk2	UTSW	11	113838646	synonymous	silent
R1913:Sdk2	UTSW	11	113856726	missense	possibly damaging	0.77
R1964:Sdk2	UTSW	11	113781017	nonsense	probably null
R2055:Sdk2	UTSW	11	113850954	missense	probably damaging	1.00
R2059:Sdk2	UTSW	11	113854332	missense	probably damaging	1.00
R2093:Sdk2	UTSW	11	113943122	missense	probably damaging	1.00
R2256:Sdk2	UTSW	11	113830794	missense	probably benign	0.44
R3720:Sdk2	UTSW	11	113800244	missense	probably damaging	1.00
R3795:Sdk2	UTSW	11	113856696	nonsense	probably null
R4037:Sdk2	UTSW	11	113795055	missense	probably damaging	1.00
R4171:Sdk2	UTSW	11	113866989	splice site	probably null
R4717:Sdk2	UTSW	11	113854369	missense	probably damaging	0.96
R4758:Sdk2	UTSW	11	113827054	missense	possibly damaging	0.87
R4857:Sdk2	UTSW	11	113821382	nonsense	probably null
R4924:Sdk2	UTSW	11	113857758	missense	probably damaging	1.00
R5015:Sdk2	UTSW	11	113793761	missense	probably damaging	1.00
R5171:Sdk2	UTSW	11	113850982	missense	probably benign	0.01
R5239:Sdk2	UTSW	11	113868033	missense	probably damaging	1.00
R5243:Sdk2	UTSW	11	113825086	missense	possibly damaging	0.76
R5279:Sdk2	UTSW	11	113867031	missense	probably benign	0.31
R5535:Sdk2	UTSW	11	113943158	missense	possibly damaging	0.80
R5634:Sdk2	UTSW	11	113851714	missense	probably damaging	1.00
R5637:Sdk2	UTSW	11	113833179	missense	probably damaging	1.00
R5726:Sdk2	UTSW	11	113851800	missense	probably damaging	1.00
R5793:Sdk2	UTSW	11	113868952	missense	possibly damaging	0.46
R5798:Sdk2	UTSW	11	113827116	missense	probably damaging	1.00
R5834:Sdk2	UTSW	11	113854273	missense	probably damaging	1.00
R5863:Sdk2	UTSW	11	113834984	missense	probably damaging	0.98
R5869:Sdk2	UTSW	11	113851882	missense	probably damaging	0.96
R5875:Sdk2	UTSW	11	113830059	missense	probably benign	0.00
R5953:Sdk2	UTSW	11	113793744	missense	probably damaging	1.00
R5991:Sdk2	UTSW	11	113943254	missense	probably damaging	0.97
R6018:Sdk2	UTSW	11	113830063	missense	probably benign	0.00
R6116:Sdk2	UTSW	11	113854364	missense	probably damaging	0.99
R6328:Sdk2	UTSW	11	113793755	missense	probably damaging	1.00
R6348:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R6383:Sdk2	UTSW	11	113832265	missense	probably damaging	1.00
R6824:Sdk2	UTSW	11	113867934	missense	probably benign	0.43
R6835:Sdk2	UTSW	11	113830048	missense	probably damaging	0.98
R6853:Sdk2	UTSW	11	113780929	missense	probably damaging	0.99
R6912:Sdk2	UTSW	11	113903120	missense	probably benign	0.03
R7000:Sdk2	UTSW	11	113803169	missense	probably damaging	1.00
R7099:Sdk2	UTSW	11	113834905	missense	probably damaging	0.98
R7102:Sdk2	UTSW	11	113842690	nonsense	probably null
R7177:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7381:Sdk2	UTSW	11	113838489	missense	probably damaging	0.98
R7412:Sdk2	UTSW	11	113868083	splice site	probably null
R7504:Sdk2	UTSW	11	113867967	missense	possibly damaging	0.50
R7552:Sdk2	UTSW	11	113873213	missense	possibly damaging	0.63
R7604:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7647:Sdk2	UTSW	11	113793737	missense	probably damaging	1.00
R7897:Sdk2	UTSW	11	113873201	missense	possibly damaging	0.50
R7931:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R7998:Sdk2	UTSW	11	113859938	missense	probably benign	0.18
R8052:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8053:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8084:Sdk2	UTSW	11	113827089	missense	possibly damaging	0.67
R8136:Sdk2	UTSW	11	113851713	missense	probably damaging	1.00
R8151:Sdk2	UTSW	11	113872857	missense	possibly damaging	0.84
R8394:Sdk2	UTSW	11	113838716	missense	probably benign
R8715:Sdk2	UTSW	11	113780902	missense	probably damaging	1.00
R8774:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8774-TAIL:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8804:Sdk2	UTSW	11	113873152	nonsense	probably null
R9136:Sdk2	UTSW	11	113806377	missense	probably damaging	1.00
R9147:Sdk2	UTSW	11	113823400	missense	probably benign	0.18
R9300:Sdk2	UTSW	11	113825030	missense	possibly damaging	0.63
R9354:Sdk2	UTSW	11	113834931	missense	probably benign	0.00
R9450:Sdk2	UTSW	11	113806279	missense	probably benign
R9462:Sdk2	UTSW	11	113869918	missense	possibly damaging	0.56
R9616:Sdk2	UTSW	11	113800235	missense	probably benign	0.05
R9678:Sdk2	UTSW	11	113794963	nonsense	probably null
RF002:Sdk2	UTSW	11	113885252	missense	probably benign	0.00
V1662:Sdk2	UTSW	11	113834908	missense	probably damaging	1.00
Z1176:Sdk2	UTSW	11	113839322	missense	probably benign	0.41
Z1176:Sdk2	UTSW	11	113851836	missense	probably damaging	0.97
Z1177:Sdk2	UTSW	11	113838659	missense	probably damaging	0.99
Z1177:Sdk2	UTSW	11	113839320	missense	probably damaging	1.00
Z1177:Sdk2	UTSW	11	113859956	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCTGACTGCTGACGAGTGATCCC -3'
(R):5'- GGTGACAAGAAATGGTCTTGCCCC -3'

Sequencing Primer
(F):5'- TCTGTGGGTACAAACCAGC -3'
(R):5'- TAGGAGTGAGTCCAGATTCTCCATC -3'

Posted On

2013-11-08