Incidental Mutation 'R0964:Ccser2'
ID81590
Institutional Source Beutler Lab
Gene Symbol Ccser2
Ensembl Gene ENSMUSG00000058690
Gene Namecoiled-coil serine rich 2
Synonyms1700012P13Rik, 2900054P12Rik, Gcap14
MMRRC Submission 039093-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R0964 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location36874936-36968777 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 36909008 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067700] [ENSMUST00000090024] [ENSMUST00000182042] [ENSMUST00000182576] [ENSMUST00000182797] [ENSMUST00000183007] [ENSMUST00000183038] [ENSMUST00000183316]
Predicted Effect probably benign
Transcript: ENSMUST00000067700
SMART Domains Protein: ENSMUSP00000068550
Gene: ENSMUSG00000058690

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
coiled coil region 157 194 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090024
SMART Domains Protein: ENSMUSP00000087478
Gene: ENSMUSG00000058690

DomainStartEndE-ValueType
low complexity region 389 412 N/A INTRINSIC
low complexity region 496 506 N/A INTRINSIC
low complexity region 543 562 N/A INTRINSIC
low complexity region 603 616 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
coiled coil region 710 747 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182042
SMART Domains Protein: ENSMUSP00000138453
Gene: ENSMUSG00000058690

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
coiled coil region 138 175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182576
SMART Domains Protein: ENSMUSP00000138318
Gene: ENSMUSG00000058690

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182635
Predicted Effect probably benign
Transcript: ENSMUST00000182797
SMART Domains Protein: ENSMUSP00000138787
Gene: ENSMUSG00000058690

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
coiled coil region 138 175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183007
Predicted Effect probably benign
Transcript: ENSMUST00000183038
SMART Domains Protein: ENSMUSP00000138718
Gene: ENSMUSG00000058690

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
coiled coil region 157 194 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183316
SMART Domains Protein: ENSMUSP00000138100
Gene: ENSMUSG00000058690

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
coiled coil region 78 115 N/A INTRINSIC
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Acacb A T 5: 114,229,752 M1604L possibly damaging Het
Acpp A G 9: 104,326,975 V40A possibly damaging Het
Adgrl1 T C 8: 83,934,412 probably benign Het
Alppl2 C T 1: 87,087,724 V372I possibly damaging Het
Apol8 C T 15: 77,749,611 S255N probably benign Het
Atp8b4 A T 2: 126,337,493 F973I probably damaging Het
Bbs4 A G 9: 59,322,976 *150Q probably null Het
Cacna1h A T 17: 25,378,775 probably benign Het
Chd9 A G 8: 91,015,204 E1607G probably benign Het
Clca4b A G 3: 144,915,576 I579T probably benign Het
Col20a1 T A 2: 180,984,485 probably benign Het
Creg2 T C 1: 39,624,976 I205V probably benign Het
Cyr61 C A 3: 145,647,748 C353F probably damaging Het
Ddx24 C T 12: 103,423,907 R275H probably damaging Het
Dip2c G A 13: 9,568,663 A579T probably benign Het
Dnah3 T C 7: 119,952,739 probably benign Het
Dnah8 G A 17: 30,673,920 probably null Het
Gckr T C 5: 31,326,915 probably benign Het
Gpbp1l1 A G 4: 116,581,239 probably benign Het
Hmcn2 A G 2: 31,391,511 T1913A probably benign Het
Lmo7 T C 14: 101,920,567 probably benign Het
Meioc G A 11: 102,680,031 V863I probably damaging Het
Myh1 A G 11: 67,205,925 I341V probably benign Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Myh13 A G 11: 67,345,002 T664A probably benign Het
Myo3b A C 2: 70,426,849 D1269A probably damaging Het
Nckap1 A G 2: 80,547,899 probably null Het
Nr3c2 A G 8: 76,908,668 probably null Het
Nxpe5 T C 5: 138,239,924 S249P probably damaging Het
Olfr1008 A G 2: 85,690,365 N312S probably benign Het
Olfr460 T C 6: 40,572,205 V273A probably benign Het
Olfr67 C T 7: 103,787,397 M293I probably benign Het
Pitpnm3 G A 11: 72,058,470 T675I probably damaging Het
Plekhm1 C A 11: 103,395,082 E176* probably null Het
Prdm11 C A 2: 92,989,222 probably benign Het
Prodh2 C A 7: 30,506,281 R218S probably damaging Het
Rps15a T C 7: 118,114,837 D54G probably benign Het
Sbno2 G T 10: 80,084,259 T46N possibly damaging Het
Sdk2 A G 11: 113,806,417 probably benign Het
Sema3c T C 5: 17,721,909 F567L probably damaging Het
Slc36a1 A G 11: 55,225,954 probably benign Het
Spaca6 A T 17: 17,838,391 E284V possibly damaging Het
Srsf3 C A 17: 29,036,438 L66I probably damaging Het
Srsf3 T A 17: 29,036,439 L66Q probably damaging Het
Syne1 T C 10: 5,043,652 T8363A possibly damaging Het
Trmt1 T A 8: 84,696,852 L298Q probably damaging Het
Uba6 T C 5: 86,119,401 I923V possibly damaging Het
Uhrf1bp1 A T 17: 27,887,178 T893S probably damaging Het
Vmn2r106 G A 17: 20,267,597 H847Y probably benign Het
Vmn2r15 T C 5: 109,297,535 T8A probably benign Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Zbtb41 T G 1: 139,439,031 F583V probably damaging Het
Zfp938 T A 10: 82,225,419 I456F probably benign Het
Other mutations in Ccser2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Ccser2 APN 14 36940064 missense probably damaging 1.00
IGL01285:Ccser2 APN 14 36938669 missense probably damaging 1.00
IGL01622:Ccser2 APN 14 36940963 missense probably benign 0.03
IGL01623:Ccser2 APN 14 36940963 missense probably benign 0.03
IGL02322:Ccser2 APN 14 36909129 missense probably damaging 1.00
IGL02342:Ccser2 APN 14 36918605 splice site probably benign
IGL02899:Ccser2 APN 14 36940759 missense probably benign 0.39
R0433:Ccser2 UTSW 14 36918529 missense probably damaging 1.00
R0543:Ccser2 UTSW 14 36940192 missense probably benign
R0674:Ccser2 UTSW 14 36918591 missense possibly damaging 0.94
R0853:Ccser2 UTSW 14 36940410 missense probably benign 0.18
R1748:Ccser2 UTSW 14 36896313 missense probably damaging 1.00
R1748:Ccser2 UTSW 14 36896314 nonsense probably null
R1854:Ccser2 UTSW 14 36918591 missense possibly damaging 0.94
R2405:Ccser2 UTSW 14 36938669 missense probably damaging 1.00
R2926:Ccser2 UTSW 14 36879561 missense possibly damaging 0.91
R3846:Ccser2 UTSW 14 36940288 missense probably benign
R4298:Ccser2 UTSW 14 36890380 missense possibly damaging 0.63
R4701:Ccser2 UTSW 14 36938697 missense probably damaging 1.00
R4746:Ccser2 UTSW 14 36909125 missense probably damaging 1.00
R4888:Ccser2 UTSW 14 36940386 missense probably damaging 0.98
R4959:Ccser2 UTSW 14 36940796 missense probably benign 0.00
R5020:Ccser2 UTSW 14 36940177 missense probably benign 0.00
R5179:Ccser2 UTSW 14 36879351 missense possibly damaging 0.79
R5378:Ccser2 UTSW 14 36879434 missense possibly damaging 0.65
R6011:Ccser2 UTSW 14 36879575 missense probably benign 0.17
R6057:Ccser2 UTSW 14 36941165 missense probably damaging 0.98
R6180:Ccser2 UTSW 14 36940319 missense probably benign
R6216:Ccser2 UTSW 14 36940508 missense probably damaging 1.00
R6244:Ccser2 UTSW 14 36940718 missense probably benign 0.00
R6266:Ccser2 UTSW 14 36879675 missense probably damaging 1.00
R6730:Ccser2 UTSW 14 36879086 missense probably damaging 1.00
R6862:Ccser2 UTSW 14 36940081 missense probably benign
R7025:Ccser2 UTSW 14 36940007 missense probably damaging 1.00
R7076:Ccser2 UTSW 14 36939829 missense probably benign 0.14
R7092:Ccser2 UTSW 14 36940655 missense probably benign 0.03
R7353:Ccser2 UTSW 14 36941143 missense possibly damaging 0.91
R7440:Ccser2 UTSW 14 36898217 missense possibly damaging 0.92
R7509:Ccser2 UTSW 14 36938645 missense probably damaging 1.00
R7555:Ccser2 UTSW 14 36879500 missense possibly damaging 0.65
X0066:Ccser2 UTSW 14 36940999 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAATCTGCTGCCAGGAACTGAAC -3'
(R):5'- GAAAGGAGTGAGCGCACCTCTAAC -3'

Sequencing Primer
(F):5'- TGCCAGGAACTGAACTGATCC -3'
(R):5'- CAGTTTTGCTAACAGGCAAGC -3'
Posted On2013-11-08