Incidental Mutation 'R0964:Vmn2r106'
ID81594
Institutional Source Beutler Lab
Gene Symbol Vmn2r106
Ensembl Gene ENSMUSG00000091656
Gene Namevomeronasal 2, receptor 106
SynonymsEG224576
MMRRC Submission 039093-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R0964 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location20267547-20285430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 20267597 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 847 (H847Y)
Ref Sequence ENSEMBL: ENSMUSP00000126534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167464]
Predicted Effect probably benign
Transcript: ENSMUST00000167464
AA Change: H847Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126534
Gene: ENSMUSG00000091656
AA Change: H847Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 471 3.8e-37 PFAM
Pfam:NCD3G 514 567 5.7e-22 PFAM
Pfam:7tm_3 596 835 1.3e-49 PFAM
Meta Mutation Damage Score 0.1936 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Acacb A T 5: 114,229,752 M1604L possibly damaging Het
Acpp A G 9: 104,326,975 V40A possibly damaging Het
Adgrl1 T C 8: 83,934,412 probably benign Het
Alppl2 C T 1: 87,087,724 V372I possibly damaging Het
Apol8 C T 15: 77,749,611 S255N probably benign Het
Atp8b4 A T 2: 126,337,493 F973I probably damaging Het
Bbs4 A G 9: 59,322,976 *150Q probably null Het
Cacna1h A T 17: 25,378,775 probably benign Het
Ccser2 C T 14: 36,909,008 probably benign Het
Chd9 A G 8: 91,015,204 E1607G probably benign Het
Clca4b A G 3: 144,915,576 I579T probably benign Het
Col20a1 T A 2: 180,984,485 probably benign Het
Creg2 T C 1: 39,624,976 I205V probably benign Het
Cyr61 C A 3: 145,647,748 C353F probably damaging Het
Ddx24 C T 12: 103,423,907 R275H probably damaging Het
Dip2c G A 13: 9,568,663 A579T probably benign Het
Dnah3 T C 7: 119,952,739 probably benign Het
Dnah8 G A 17: 30,673,920 probably null Het
Gckr T C 5: 31,326,915 probably benign Het
Gpbp1l1 A G 4: 116,581,239 probably benign Het
Hmcn2 A G 2: 31,391,511 T1913A probably benign Het
Lmo7 T C 14: 101,920,567 probably benign Het
Meioc G A 11: 102,680,031 V863I probably damaging Het
Myh1 A G 11: 67,205,925 I341V probably benign Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Myh13 A G 11: 67,345,002 T664A probably benign Het
Myo3b A C 2: 70,426,849 D1269A probably damaging Het
Nckap1 A G 2: 80,547,899 probably null Het
Nr3c2 A G 8: 76,908,668 probably null Het
Nxpe5 T C 5: 138,239,924 S249P probably damaging Het
Olfr1008 A G 2: 85,690,365 N312S probably benign Het
Olfr460 T C 6: 40,572,205 V273A probably benign Het
Olfr67 C T 7: 103,787,397 M293I probably benign Het
Pitpnm3 G A 11: 72,058,470 T675I probably damaging Het
Plekhm1 C A 11: 103,395,082 E176* probably null Het
Prdm11 C A 2: 92,989,222 probably benign Het
Prodh2 C A 7: 30,506,281 R218S probably damaging Het
Rps15a T C 7: 118,114,837 D54G probably benign Het
Sbno2 G T 10: 80,084,259 T46N possibly damaging Het
Sdk2 A G 11: 113,806,417 probably benign Het
Sema3c T C 5: 17,721,909 F567L probably damaging Het
Slc36a1 A G 11: 55,225,954 probably benign Het
Spaca6 A T 17: 17,838,391 E284V possibly damaging Het
Srsf3 C A 17: 29,036,438 L66I probably damaging Het
Srsf3 T A 17: 29,036,439 L66Q probably damaging Het
Syne1 T C 10: 5,043,652 T8363A possibly damaging Het
Trmt1 T A 8: 84,696,852 L298Q probably damaging Het
Uba6 T C 5: 86,119,401 I923V possibly damaging Het
Uhrf1bp1 A T 17: 27,887,178 T893S probably damaging Het
Vmn2r15 T C 5: 109,297,535 T8A probably benign Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Zbtb41 T G 1: 139,439,031 F583V probably damaging Het
Zfp938 T A 10: 82,225,419 I456F probably benign Het
Other mutations in Vmn2r106
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Vmn2r106 APN 17 20277575 missense possibly damaging 0.90
IGL01313:Vmn2r106 APN 17 20278389 missense probably damaging 0.99
IGL01419:Vmn2r106 APN 17 20279545 missense probably benign 0.06
IGL01574:Vmn2r106 APN 17 20268310 missense possibly damaging 0.94
IGL01796:Vmn2r106 APN 17 20268052 missense possibly damaging 0.79
IGL01893:Vmn2r106 APN 17 20277468 missense probably benign 0.06
IGL01895:Vmn2r106 APN 17 20278965 missense probably benign 0.02
IGL02378:Vmn2r106 APN 17 20277529 missense probably damaging 1.00
IGL02430:Vmn2r106 APN 17 20278896 missense probably benign 0.38
IGL02664:Vmn2r106 APN 17 20268082 missense possibly damaging 0.88
IGL03308:Vmn2r106 APN 17 20278523 nonsense probably null
IGL03384:Vmn2r106 APN 17 20268143 missense probably damaging 0.99
R0401:Vmn2r106 UTSW 17 20279019 missense possibly damaging 0.86
R0842:Vmn2r106 UTSW 17 20268203 missense probably damaging 1.00
R1235:Vmn2r106 UTSW 17 20279479 missense probably benign 0.00
R1709:Vmn2r106 UTSW 17 20279111 missense probably benign 0.12
R1712:Vmn2r106 UTSW 17 20278735 missense probably benign 0.01
R1770:Vmn2r106 UTSW 17 20268298 missense probably damaging 0.99
R2049:Vmn2r106 UTSW 17 20268304 missense possibly damaging 0.90
R2245:Vmn2r106 UTSW 17 20268161 missense probably benign 0.13
R2336:Vmn2r106 UTSW 17 20268208 missense probably benign 0.18
R2910:Vmn2r106 UTSW 17 20278684 missense probably damaging 1.00
R3025:Vmn2r106 UTSW 17 20278885 missense probably benign 0.00
R3944:Vmn2r106 UTSW 17 20267651 missense probably damaging 1.00
R4081:Vmn2r106 UTSW 17 20267556 nonsense probably null
R4153:Vmn2r106 UTSW 17 20267818 missense probably damaging 1.00
R4356:Vmn2r106 UTSW 17 20279648 missense probably benign 0.06
R4426:Vmn2r106 UTSW 17 20285379 missense probably benign 0.00
R4590:Vmn2r106 UTSW 17 20277466 missense probably damaging 0.99
R4661:Vmn2r106 UTSW 17 20267623 missense probably benign 0.10
R5106:Vmn2r106 UTSW 17 20279133 critical splice acceptor site probably null
R5341:Vmn2r106 UTSW 17 20277526 missense probably benign 0.00
R5509:Vmn2r106 UTSW 17 20278422 missense probably damaging 0.99
R5826:Vmn2r106 UTSW 17 20278871 missense probably benign
R5859:Vmn2r106 UTSW 17 20285321 missense possibly damaging 0.72
R5937:Vmn2r106 UTSW 17 20285405 nonsense probably null
R5972:Vmn2r106 UTSW 17 20278476 missense probably benign
R6056:Vmn2r106 UTSW 17 20267544 unclassified probably null
R6108:Vmn2r106 UTSW 17 20268376 missense probably benign 0.11
R6114:Vmn2r106 UTSW 17 20268376 missense probably benign 0.11
R6115:Vmn2r106 UTSW 17 20268376 missense probably benign 0.11
R6132:Vmn2r106 UTSW 17 20268404 missense probably benign
R6208:Vmn2r106 UTSW 17 20268329 missense probably damaging 0.99
R6217:Vmn2r106 UTSW 17 20268239 missense probably benign 0.10
R6289:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6378:Vmn2r106 UTSW 17 20278405 missense probably benign 0.19
R6390:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6391:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6392:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6405:Vmn2r106 UTSW 17 20279099 missense probably benign 0.22
R6427:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6428:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6435:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6436:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6437:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6511:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6512:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6587:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6703:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6730:Vmn2r106 UTSW 17 20278834 missense possibly damaging 0.64
R6961:Vmn2r106 UTSW 17 20268384 nonsense probably null
R7054:Vmn2r106 UTSW 17 20278920 missense probably damaging 0.96
R7379:Vmn2r106 UTSW 17 20267775 missense possibly damaging 0.75
R7402:Vmn2r106 UTSW 17 20267621 missense probably damaging 0.99
R7497:Vmn2r106 UTSW 17 20267939 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCAGAAGGCAGATGTGGTTTTA -3'
(R):5'- TCTGCTCCTTGGCATTTGGAGGATA -3'

Sequencing Primer
(F):5'- GCATATGATTAGGTGGCATGAAG -3'
(R):5'- TCTACCTGGCACATTCAATGAATC -3'
Posted On2013-11-08