Incidental Mutation 'R0964:Uhrf1bp1'
ID81596
Institutional Source Beutler Lab
Gene Symbol Uhrf1bp1
Ensembl Gene ENSMUSG00000039512
Gene NameUHRF1 (ICBP90) binding protein 1
Synonyms1110020K19Rik, F830021D11Rik
MMRRC Submission 039093-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0964 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location27856490-27900040 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27887178 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 893 (T893S)
Ref Sequence ENSEMBL: ENSMUSP00000110499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114849]
Predicted Effect probably damaging
Transcript: ENSMUST00000114849
AA Change: T893S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110499
Gene: ENSMUSG00000039512
AA Change: T893S

DomainStartEndE-ValueType
Pfam:Chorein_N 1 104 2.6e-18 PFAM
low complexity region 234 247 N/A INTRINSIC
low complexity region 297 306 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
low complexity region 1200 1216 N/A INTRINSIC
low complexity region 1322 1333 N/A INTRINSIC
low complexity region 1375 1386 N/A INTRINSIC
coiled coil region 1394 1424 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137825
Meta Mutation Damage Score 0.0650 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Acacb A T 5: 114,229,752 M1604L possibly damaging Het
Acpp A G 9: 104,326,975 V40A possibly damaging Het
Adgrl1 T C 8: 83,934,412 probably benign Het
Alppl2 C T 1: 87,087,724 V372I possibly damaging Het
Apol8 C T 15: 77,749,611 S255N probably benign Het
Atp8b4 A T 2: 126,337,493 F973I probably damaging Het
Bbs4 A G 9: 59,322,976 *150Q probably null Het
Cacna1h A T 17: 25,378,775 probably benign Het
Ccser2 C T 14: 36,909,008 probably benign Het
Chd9 A G 8: 91,015,204 E1607G probably benign Het
Clca4b A G 3: 144,915,576 I579T probably benign Het
Col20a1 T A 2: 180,984,485 probably benign Het
Creg2 T C 1: 39,624,976 I205V probably benign Het
Cyr61 C A 3: 145,647,748 C353F probably damaging Het
Ddx24 C T 12: 103,423,907 R275H probably damaging Het
Dip2c G A 13: 9,568,663 A579T probably benign Het
Dnah3 T C 7: 119,952,739 probably benign Het
Dnah8 G A 17: 30,673,920 probably null Het
Gckr T C 5: 31,326,915 probably benign Het
Gpbp1l1 A G 4: 116,581,239 probably benign Het
Hmcn2 A G 2: 31,391,511 T1913A probably benign Het
Lmo7 T C 14: 101,920,567 probably benign Het
Meioc G A 11: 102,680,031 V863I probably damaging Het
Myh1 A G 11: 67,205,925 I341V probably benign Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Myh13 A G 11: 67,345,002 T664A probably benign Het
Myo3b A C 2: 70,426,849 D1269A probably damaging Het
Nckap1 A G 2: 80,547,899 probably null Het
Nr3c2 A G 8: 76,908,668 probably null Het
Nxpe5 T C 5: 138,239,924 S249P probably damaging Het
Olfr1008 A G 2: 85,690,365 N312S probably benign Het
Olfr460 T C 6: 40,572,205 V273A probably benign Het
Olfr67 C T 7: 103,787,397 M293I probably benign Het
Pitpnm3 G A 11: 72,058,470 T675I probably damaging Het
Plekhm1 C A 11: 103,395,082 E176* probably null Het
Prdm11 C A 2: 92,989,222 probably benign Het
Prodh2 C A 7: 30,506,281 R218S probably damaging Het
Rps15a T C 7: 118,114,837 D54G probably benign Het
Sbno2 G T 10: 80,084,259 T46N possibly damaging Het
Sdk2 A G 11: 113,806,417 probably benign Het
Sema3c T C 5: 17,721,909 F567L probably damaging Het
Slc36a1 A G 11: 55,225,954 probably benign Het
Spaca6 A T 17: 17,838,391 E284V possibly damaging Het
Srsf3 C A 17: 29,036,438 L66I probably damaging Het
Srsf3 T A 17: 29,036,439 L66Q probably damaging Het
Syne1 T C 10: 5,043,652 T8363A possibly damaging Het
Trmt1 T A 8: 84,696,852 L298Q probably damaging Het
Uba6 T C 5: 86,119,401 I923V possibly damaging Het
Vmn2r106 G A 17: 20,267,597 H847Y probably benign Het
Vmn2r15 T C 5: 109,297,535 T8A probably benign Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Zbtb41 T G 1: 139,439,031 F583V probably damaging Het
Zfp938 T A 10: 82,225,419 I456F probably benign Het
Other mutations in Uhrf1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Uhrf1bp1 APN 17 27876917 splice site probably benign
IGL00786:Uhrf1bp1 APN 17 27879292 missense probably damaging 0.99
IGL01074:Uhrf1bp1 APN 17 27879291 missense possibly damaging 0.94
IGL01780:Uhrf1bp1 APN 17 27893500 missense probably damaging 1.00
IGL02668:Uhrf1bp1 APN 17 27886575 missense possibly damaging 0.53
IGL02686:Uhrf1bp1 APN 17 27894589 missense probably benign
IGL03240:Uhrf1bp1 APN 17 27893253 missense probably benign 0.37
hades UTSW 17 27894746 missense probably damaging 1.00
R0167:Uhrf1bp1 UTSW 17 27880202 missense possibly damaging 0.46
R0240:Uhrf1bp1 UTSW 17 27895870 splice site probably benign
R0332:Uhrf1bp1 UTSW 17 27893294 critical splice donor site probably null
R0668:Uhrf1bp1 UTSW 17 27895939 missense probably benign 0.16
R0726:Uhrf1bp1 UTSW 17 27885489 missense possibly damaging 0.50
R1125:Uhrf1bp1 UTSW 17 27893449 missense probably damaging 1.00
R1139:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1164:Uhrf1bp1 UTSW 17 27895380 critical splice donor site probably null
R1192:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1277:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1279:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1340:Uhrf1bp1 UTSW 17 27894721 missense probably benign 0.00
R1341:Uhrf1bp1 UTSW 17 27877419 splice site probably benign
R1344:Uhrf1bp1 UTSW 17 27894577 missense probably benign 0.41
R1418:Uhrf1bp1 UTSW 17 27894577 missense probably benign 0.41
R1552:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1726:Uhrf1bp1 UTSW 17 27886251 splice site probably null
R1791:Uhrf1bp1 UTSW 17 27894746 missense probably damaging 1.00
R1796:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R2858:Uhrf1bp1 UTSW 17 27885462 missense probably damaging 0.99
R3034:Uhrf1bp1 UTSW 17 27894746 missense probably damaging 1.00
R4111:Uhrf1bp1 UTSW 17 27886090 nonsense probably null
R4159:Uhrf1bp1 UTSW 17 27884087 missense probably damaging 1.00
R4160:Uhrf1bp1 UTSW 17 27884087 missense probably damaging 1.00
R4161:Uhrf1bp1 UTSW 17 27884087 missense probably damaging 1.00
R4431:Uhrf1bp1 UTSW 17 27885931 missense probably damaging 1.00
R4575:Uhrf1bp1 UTSW 17 27887503 missense probably benign 0.02
R4657:Uhrf1bp1 UTSW 17 27890105 missense probably benign 0.09
R4666:Uhrf1bp1 UTSW 17 27893503 missense possibly damaging 0.95
R4825:Uhrf1bp1 UTSW 17 27877394 missense probably damaging 0.98
R4872:Uhrf1bp1 UTSW 17 27890136 missense probably benign 0.10
R4956:Uhrf1bp1 UTSW 17 27889984 splice site probably null
R4976:Uhrf1bp1 UTSW 17 27884026 missense probably damaging 0.99
R4982:Uhrf1bp1 UTSW 17 27886606 missense probably benign 0.05
R5017:Uhrf1bp1 UTSW 17 27894739 nonsense probably null
R5033:Uhrf1bp1 UTSW 17 27886864 missense probably damaging 0.99
R5137:Uhrf1bp1 UTSW 17 27876990 splice site probably null
R5159:Uhrf1bp1 UTSW 17 27881556 missense probably damaging 0.98
R5177:Uhrf1bp1 UTSW 17 27885018 missense possibly damaging 0.94
R5196:Uhrf1bp1 UTSW 17 27856763 missense probably benign 0.09
R5214:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5352:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5354:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5425:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5601:Uhrf1bp1 UTSW 17 27884494 missense probably damaging 1.00
R6080:Uhrf1bp1 UTSW 17 27880297 missense probably benign
R6088:Uhrf1bp1 UTSW 17 27884605 critical splice donor site probably null
R6331:Uhrf1bp1 UTSW 17 27893201 missense probably benign 0.01
R6529:Uhrf1bp1 UTSW 17 27879776 missense possibly damaging 0.90
R6614:Uhrf1bp1 UTSW 17 27876925 missense probably benign 0.18
R6701:Uhrf1bp1 UTSW 17 27887357 nonsense probably null
R7082:Uhrf1bp1 UTSW 17 27890065 missense probably damaging 1.00
R7158:Uhrf1bp1 UTSW 17 27886433 nonsense probably null
R8338:Uhrf1bp1 UTSW 17 27876695 missense probably damaging 1.00
RF005:Uhrf1bp1 UTSW 17 27885531 missense probably damaging 1.00
X0017:Uhrf1bp1 UTSW 17 27877341 missense probably benign 0.03
Z1176:Uhrf1bp1 UTSW 17 27876676 missense probably damaging 1.00
Z1176:Uhrf1bp1 UTSW 17 27886306 missense probably damaging 1.00
Z1177:Uhrf1bp1 UTSW 17 27884966 missense not run
Predicted Primers PCR Primer
(F):5'- GCTGACATTCACATGCTTGTCCAC -3'
(R):5'- TAGCTTCTTGGCCTGGAGAGACTC -3'

Sequencing Primer
(F):5'- CATGTCAGAGTGAGGCTCGAC -3'
(R):5'- AGAGACTCGACCGCCTC -3'
Posted On2013-11-08