Mutagenetix > Incidental Mutation

Incidental Mutation 'R0965:Gtf3c3'

81600

Institutional Source

Beutler Lab

Gene Symbol

Gtf3c3

Ensembl Gene

ENSMUSG00000041303

Gene Name

general transcription factor IIIC, polypeptide 3

Synonyms

MMRRC Submission

039094-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.959) question?

Stock #

R0965 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

54435163-54478130 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 54456937 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 488 (A488T)

Ref Sequence

ENSEMBL: ENSMUSP00000039420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041638]

AlphaFold

Q3TMP1

Predicted Effect

probably damaging
Transcript: ENSMUST00000041638
AA Change: A488T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000039420
Gene: ENSMUSG00000041303
AA Change: A488T

Domain	Start	End	E-Value	Type
low complexity region	18	34	N/A	INTRINSIC
low complexity region	92	108	N/A	INTRINSIC
TPR	145	178	9.24e1	SMART
TPR	179	212	2.36e1	SMART
TPR	213	246	4.58e-4	SMART
TPR	247	280	6.4e1	SMART
Blast:TPR	286	319	6e-9	BLAST
low complexity region	353	365	N/A	INTRINSIC
TPR	452	485	1.87e1	SMART
low complexity region	549	560	N/A	INTRINSIC
TPR	807	840	3.27e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190419

Meta Mutation Damage Score

0.6542

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.1%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the TFIIIC2 complex, which binds to the promoters of small nuclear and cytoplasmic RNA genes in order to recruit RNA polymerase III. The TFIIIC2 complex is composed of six subunits. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb2	AGAGGAGGAGGAGGAGGAGG	AGAGGAGGAGGAGGAGG	4: 129,886,209 (GRCm39)		probably benign	Het
Amacr	C	T	15: 10,984,891 (GRCm39)	R170C	probably damaging	Het
Bcl2	A	T	1: 106,640,021 (GRCm39)	L197Q	probably benign	Het
Brd1	G	A	15: 88,601,231 (GRCm39)	R468W	probably damaging	Het
Esco1	A	G	18: 10,567,570 (GRCm39)	F821L	probably damaging	Het
Gzma	G	A	13: 113,234,868 (GRCm39)	P38L	probably damaging	Het
Mcc	A	G	18: 44,857,593 (GRCm39)	L174P	probably benign	Het
Med19	A	G	2: 84,508,793 (GRCm39)	E2G	probably damaging	Het
Muc5b	C	T	7: 141,417,539 (GRCm39)	T3495I	possibly damaging	Het
Nfatc4	T	C	14: 56,064,043 (GRCm39)	S107P	probably damaging	Het
Obscn	T	C	11: 59,022,472 (GRCm39)	R758G	possibly damaging	Het
Or9g4b	A	G	2: 85,616,643 (GRCm39)	S263G	probably damaging	Het
Phf11c	T	A	14: 59,618,931 (GRCm39)	I285F	probably damaging	Het
Prkdc	T	C	16: 15,647,580 (GRCm39)	V3668A	probably benign	Het
Rbm20	T	C	19: 53,847,832 (GRCm39)	F1126S	probably damaging	Het
Slc7a5	T	C	8: 122,633,840 (GRCm39)	E169G	probably benign	Het
Slco1b2	C	A	6: 141,631,322 (GRCm39)	T652K	probably damaging	Het
Sned1	G	A	1: 93,209,376 (GRCm39)	V830M	possibly damaging	Het
Tmem119	A	C	5: 113,933,480 (GRCm39)	V107G	probably damaging	Het
Ttn	C	A	2: 76,629,915 (GRCm39)	G14205V	probably damaging	Het
Zc3h11a	T	C	1: 133,573,541 (GRCm39)	N33S	possibly damaging	Het

Other mutations in Gtf3c3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Gtf3c3	APN	1	54,455,114 (GRCm39)	missense	probably damaging	0.99
IGL00435:Gtf3c3	APN	1	54,466,694 (GRCm39)	missense	possibly damaging	0.73
IGL01128:Gtf3c3	APN	1	54,468,035 (GRCm39)	missense	possibly damaging	0.91
R0243:Gtf3c3	UTSW	1	54,442,695 (GRCm39)	missense	possibly damaging	0.60
R0271:Gtf3c3	UTSW	1	54,467,971 (GRCm39)	missense	possibly damaging	0.96
R0571:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R0968:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1069:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1070:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1111:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1112:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1113:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1114:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1115:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1117:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1118:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1119:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1228:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1230:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1231:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1313:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1313:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1382:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1394:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1395:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1397:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1414:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1430:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1432:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1473:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1497:Gtf3c3	UTSW	1	54,477,098 (GRCm39)	missense	probably benign
R1556:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1563:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1638:Gtf3c3	UTSW	1	54,444,278 (GRCm39)	missense	probably damaging	1.00
R1695:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1716:Gtf3c3	UTSW	1	54,438,419 (GRCm39)	missense	probably damaging	1.00
R1745:Gtf3c3	UTSW	1	54,473,371 (GRCm39)	missense	probably damaging	1.00
R1767:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1799:Gtf3c3	UTSW	1	54,459,583 (GRCm39)	missense	possibly damaging	0.82
R1861:Gtf3c3	UTSW	1	54,477,997 (GRCm39)	missense	possibly damaging	0.87
R1940:Gtf3c3	UTSW	1	54,468,117 (GRCm39)	splice site	probably benign
R3804:Gtf3c3	UTSW	1	54,463,166 (GRCm39)	critical splice donor site	probably null
R4496:Gtf3c3	UTSW	1	54,463,291 (GRCm39)	missense	probably benign	0.03
R4621:Gtf3c3	UTSW	1	54,458,575 (GRCm39)	missense	probably damaging	1.00
R5131:Gtf3c3	UTSW	1	54,458,657 (GRCm39)	splice site	probably null
R5320:Gtf3c3	UTSW	1	54,445,032 (GRCm39)	missense	probably damaging	1.00
R5605:Gtf3c3	UTSW	1	54,455,085 (GRCm39)	missense	probably benign	0.06
R5854:Gtf3c3	UTSW	1	54,458,596 (GRCm39)	missense	probably benign	0.01
R6050:Gtf3c3	UTSW	1	54,445,229 (GRCm39)	missense	probably benign	0.00
R6441:Gtf3c3	UTSW	1	54,445,197 (GRCm39)	missense	probably benign	0.03
R6892:Gtf3c3	UTSW	1	54,455,100 (GRCm39)	missense	probably benign	0.00
R7114:Gtf3c3	UTSW	1	54,462,666 (GRCm39)	missense	probably benign
R7299:Gtf3c3	UTSW	1	54,456,867 (GRCm39)	missense	probably benign	0.01
R7441:Gtf3c3	UTSW	1	54,459,607 (GRCm39)	missense	probably benign	0.00
R7586:Gtf3c3	UTSW	1	54,442,752 (GRCm39)	missense	probably damaging	1.00
R7615:Gtf3c3	UTSW	1	54,462,731 (GRCm39)	missense	possibly damaging	0.49
R7634:Gtf3c3	UTSW	1	54,458,800 (GRCm39)	splice site	probably null
R7739:Gtf3c3	UTSW	1	54,444,198 (GRCm39)	missense	possibly damaging	0.94
R8349:Gtf3c3	UTSW	1	54,468,068 (GRCm39)	missense	probably damaging	1.00
R8449:Gtf3c3	UTSW	1	54,468,068 (GRCm39)	missense	probably damaging	1.00
R8755:Gtf3c3	UTSW	1	54,468,031 (GRCm39)	missense	probably benign
R8955:Gtf3c3	UTSW	1	54,462,722 (GRCm39)	missense	probably benign	0.00
R9290:Gtf3c3	UTSW	1	54,477,997 (GRCm39)	missense	possibly damaging	0.87
R9353:Gtf3c3	UTSW	1	54,445,211 (GRCm39)	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- GCCATGCAAGCCTAAAGACCTGAG -3'
(R):5'- AGGATTGCAAATCAGTGAGGCTGTG -3'

Sequencing Primer
(F):5'- gaaggaccctgatgctcac -3'
(R):5'- TCAGTGAGGCTGTGTCATAAAG -3'

Posted On

2013-11-08