Incidental Mutation 'R0965:Bcl2'
ID81602
Institutional Source Beutler Lab
Gene Symbol Bcl2
Ensembl Gene ENSMUSG00000057329
Gene NameB cell leukemia/lymphoma 2
SynonymsD830018M01Rik, C430015F12Rik, Bcl-2
MMRRC Submission 039094-MU
Accession Numbers

MGI: 88138

Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R0965 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location106538178-106714274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106712291 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 197 (L197Q)
Ref Sequence ENSEMBL: ENSMUSP00000139856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112751] [ENSMUST00000189999]
Predicted Effect probably benign
Transcript: ENSMUST00000112751
SMART Domains Protein: ENSMUSP00000108371
Gene: ENSMUSG00000057329

DomainStartEndE-ValueType
BH4 7 33 1.13e-12 SMART
BCL 94 192 4.43e-48 SMART
transmembrane domain 211 233 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189999
AA Change: L197Q

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139856
Gene: ENSMUSG00000057329
AA Change: L197Q

DomainStartEndE-ValueType
BH4 7 33 1.13e-12 SMART
BCL 94 192 4.43e-48 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the B cell lymphoma 2 protein family. Members of this family regulate cell death in multiple cell types and can have either proapoptotic or antiapoptotic activities. The protein encoded by this gene inhibits mitochondrial-mediated apoptosis. This protein is an integral outer mitochondrial membrane protein that functions as part of signaling pathway that controls mitochondrial permeability in response to apoptotic stimuli. This protein may also play a role in neuron cell survival and autophagy. Abnormal expression and chromosomal translocations of this gene are associated with cancer progression in numerous tissues. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants show pleiotropic abnormalities including small size, increased postnatal mortality, polycystic kidneys, apoptotic involution of thymus and spleen, graying in the second hair follicle cycle, and reduced numbers of motor, sympathetic and sensory neurons. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(8) Gene trapped(2) Chemically induced(1)          

Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 AGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGG 4: 129,992,416 probably benign Het
Amacr C T 15: 10,984,805 R170C probably damaging Het
Brd1 G A 15: 88,717,028 R468W probably damaging Het
Esco1 A G 18: 10,567,570 F821L probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Gzma G A 13: 113,098,334 P38L probably damaging Het
Mcc A G 18: 44,724,526 L174P probably benign Het
Med19 A G 2: 84,678,449 E2G probably damaging Het
Muc5b C T 7: 141,863,802 T3495I possibly damaging Het
Nfatc4 T C 14: 55,826,586 S107P probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1015 A G 2: 85,786,299 S263G probably damaging Het
Phf11c T A 14: 59,381,482 I285F probably damaging Het
Prkdc T C 16: 15,829,716 V3668A probably benign Het
Rbm20 T C 19: 53,859,401 F1126S probably damaging Het
Slc7a5 T C 8: 121,907,101 E169G probably benign Het
Slco1b2 C A 6: 141,685,596 T652K probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tmem119 A C 5: 113,795,419 V107G probably damaging Het
Ttn C A 2: 76,799,571 G14205V probably damaging Het
Zc3h11a T C 1: 133,645,803 N33S possibly damaging Het
Other mutations in Bcl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Bcl2 APN 1 106712358 missense possibly damaging 0.95
IGL03076:Bcl2 APN 1 106543307 missense probably benign 0.24
Croce UTSW 1 106543281 missense probably damaging 1.00
R0002:Bcl2 UTSW 1 106712511 missense possibly damaging 0.94
R0002:Bcl2 UTSW 1 106712511 missense possibly damaging 0.94
R0083:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0086:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0107:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0183:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0217:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0219:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0346:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0347:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0348:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0361:Bcl2 UTSW 1 106712694 missense probably damaging 0.96
R0470:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0471:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0601:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0609:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R1756:Bcl2 UTSW 1 106712392 missense probably damaging 1.00
R2764:Bcl2 UTSW 1 106712436 missense probably damaging 1.00
R4798:Bcl2 UTSW 1 106712608 missense possibly damaging 0.57
R4922:Bcl2 UTSW 1 106712646 missense probably benign 0.00
R6864:Bcl2 UTSW 1 106543281 missense probably damaging 1.00
R7576:Bcl2 UTSW 1 106712423 missense possibly damaging 0.64
R7837:Bcl2 UTSW 1 106543356 missense possibly damaging 0.93
R7920:Bcl2 UTSW 1 106543356 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGGTGCTTACACAGGACCCAGAAC -3'
(R):5'- GACTTCGCAGAGATGTCCAGTCAG -3'

Sequencing Primer
(F):5'- CCTACTGGATCAAAAATGCTGG -3'
(R):5'- CTCTTCAGGGATGGGGTGAAC -3'
Posted On2013-11-08