Incidental Mutation 'R0965:Med19'
ID81605
Institutional Source Beutler Lab
Gene Symbol Med19
Ensembl Gene ENSMUSG00000027080
Gene Namemediator complex subunit 19
SynonymsLCMR1, 3110040A13Rik, 2410018M14Rik
MMRRC Submission 039094-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R0965 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location84678402-84688215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84678449 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2 (E2G)
Ref Sequence ENSEMBL: ENSMUSP00000099705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053664] [ENSMUST00000102645] [ENSMUST00000111664] [ENSMUST00000111665] [ENSMUST00000152149] [ENSMUST00000189772]
Predicted Effect probably benign
Transcript: ENSMUST00000053664
SMART Domains Protein: ENSMUSP00000059582
Gene: ENSMUSG00000050043

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
Pfam:Thioredoxin 137 243 3.6e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102645
AA Change: E2G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099705
Gene: ENSMUSG00000027080
AA Change: E2G

DomainStartEndE-ValueType
low complexity region 24 55 N/A INTRINSIC
Pfam:Med19 63 234 4e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111664
SMART Domains Protein: ENSMUSP00000107293
Gene: ENSMUSG00000050043

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
Pfam:Thioredoxin 99 205 1.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111665
SMART Domains Protein: ENSMUSP00000107294
Gene: ENSMUSG00000050043

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
Pfam:Thioredoxin 137 243 3.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138529
Predicted Effect probably benign
Transcript: ENSMUST00000152149
SMART Domains Protein: ENSMUSP00000115745
Gene: ENSMUSG00000050043

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189772
SMART Domains Protein: ENSMUSP00000141166
Gene: ENSMUSG00000101645

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the Mediator complex, which binds to gene-specific regulatory factors and provides support for the basal RNA polymerase II transcription machinery. This gene has been implicated in the growth of several types of cancer, and inhibition of its expression inhibits the growth and spread of these cancers. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 AGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGG 4: 129,992,416 probably benign Het
Amacr C T 15: 10,984,805 R170C probably damaging Het
Bcl2 A T 1: 106,712,291 L197Q probably benign Het
Brd1 G A 15: 88,717,028 R468W probably damaging Het
Esco1 A G 18: 10,567,570 F821L probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Gzma G A 13: 113,098,334 P38L probably damaging Het
Mcc A G 18: 44,724,526 L174P probably benign Het
Muc5b C T 7: 141,863,802 T3495I possibly damaging Het
Nfatc4 T C 14: 55,826,586 S107P probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1015 A G 2: 85,786,299 S263G probably damaging Het
Phf11c T A 14: 59,381,482 I285F probably damaging Het
Prkdc T C 16: 15,829,716 V3668A probably benign Het
Rbm20 T C 19: 53,859,401 F1126S probably damaging Het
Slc7a5 T C 8: 121,907,101 E169G probably benign Het
Slco1b2 C A 6: 141,685,596 T652K probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tmem119 A C 5: 113,795,419 V107G probably damaging Het
Ttn C A 2: 76,799,571 G14205V probably damaging Het
Zc3h11a T C 1: 133,645,803 N33S possibly damaging Het
Other mutations in Med19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02148:Med19 APN 2 84685259 missense probably damaging 1.00
IGL02175:Med19 APN 2 84678663 critical splice donor site probably null
IGL02378:Med19 APN 2 84685281 missense probably damaging 1.00
R1935:Med19 UTSW 2 84685658 missense possibly damaging 0.73
R2316:Med19 UTSW 2 84686243 missense probably benign 0.15
R7857:Med19 UTSW 2 84685625 missense probably damaging 1.00
R7940:Med19 UTSW 2 84685625 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTATTAGTCTGCGAACCACCTTCC -3'
(R):5'- ATCGCCAAAGGGCTTCTGACAC -3'

Sequencing Primer
(F):5'- CTAACCAGTCTCTCAGGCG -3'
(R):5'- CCTGAACTACAATCTGAGTGGC -3'
Posted On2013-11-08