Incidental Mutation 'R0965:Slco1b2'
ID81610
Institutional Source Beutler Lab
Gene Symbol Slco1b2
Ensembl Gene ENSMUSG00000030236
Gene Namesolute carrier organic anion transporter family, member 1b2
Synonyms7330442B20Rik, Slc21a6, mlst-1, Oatp1b2, Slc21a10
MMRRC Submission 039094-MU
Accession Numbers

Genbank: NM_020495; MGI: 

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0965 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location141629518-141686646 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 141685596 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 652 (T652K)
Ref Sequence ENSEMBL: ENSMUSP00000144747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042812] [ENSMUST00000203597]
Predicted Effect probably damaging
Transcript: ENSMUST00000042812
AA Change: T687K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044326
Gene: ENSMUSG00000030236
AA Change: T687K

DomainStartEndE-ValueType
Pfam:MFS_1 27 443 6.1e-21 PFAM
KAZAL 457 501 8.81e-4 SMART
transmembrane domain 620 642 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160179
Predicted Effect probably damaging
Transcript: ENSMUST00000203597
AA Change: T652K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144747
Gene: ENSMUSG00000030236
AA Change: T652K

DomainStartEndE-ValueType
Pfam:MFS_1 27 405 8.4e-19 PFAM
KAZAL 422 466 5.7e-6 SMART
transmembrane domain 497 519 N/A INTRINSIC
transmembrane domain 534 556 N/A INTRINSIC
transmembrane domain 585 607 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a liver-specific member of the organic anion transporter family. The encoded protein is a transmembrane receptor that mediates the sodium-independent uptake of endogenous and xenobiotic compounds and plays a critical role in bile acid and bilirubin transport. Mutations in this gene are a cause of Rotor type hyperbilirubinemia. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null mutation display slight abnormalities in blood chemistry and are resistant to injury induced by some classes of hepatotoxins. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 AGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGG 4: 129,992,416 probably benign Het
Amacr C T 15: 10,984,805 R170C probably damaging Het
Bcl2 A T 1: 106,712,291 L197Q probably benign Het
Brd1 G A 15: 88,717,028 R468W probably damaging Het
Esco1 A G 18: 10,567,570 F821L probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Gzma G A 13: 113,098,334 P38L probably damaging Het
Mcc A G 18: 44,724,526 L174P probably benign Het
Med19 A G 2: 84,678,449 E2G probably damaging Het
Muc5b C T 7: 141,863,802 T3495I possibly damaging Het
Nfatc4 T C 14: 55,826,586 S107P probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1015 A G 2: 85,786,299 S263G probably damaging Het
Phf11c T A 14: 59,381,482 I285F probably damaging Het
Prkdc T C 16: 15,829,716 V3668A probably benign Het
Rbm20 T C 19: 53,859,401 F1126S probably damaging Het
Slc7a5 T C 8: 121,907,101 E169G probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tmem119 A C 5: 113,795,419 V107G probably damaging Het
Ttn C A 2: 76,799,571 G14205V probably damaging Het
Zc3h11a T C 1: 133,645,803 N33S possibly damaging Het
Other mutations in Slco1b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Slco1b2 APN 6 141655352 missense probably damaging 0.99
IGL01583:Slco1b2 APN 6 141663672 missense possibly damaging 0.85
IGL01909:Slco1b2 APN 6 141648586 missense probably damaging 1.00
IGL01943:Slco1b2 APN 6 141676286 missense possibly damaging 0.71
IGL01952:Slco1b2 APN 6 141671230 missense probably benign 0.01
IGL02186:Slco1b2 APN 6 141634545 splice site probably benign
IGL02309:Slco1b2 APN 6 141672281 missense probably damaging 1.00
IGL02352:Slco1b2 APN 6 141685525 missense probably damaging 0.96
IGL02359:Slco1b2 APN 6 141685525 missense probably damaging 0.96
IGL02524:Slco1b2 APN 6 141671072 missense probably benign 0.03
IGL02701:Slco1b2 APN 6 141685545 missense probably benign 0.35
IGL02962:Slco1b2 APN 6 141648553 missense probably damaging 0.99
3-1:Slco1b2 UTSW 6 141669463 missense probably benign 0.01
IGL03052:Slco1b2 UTSW 6 141648585 missense probably benign 0.13
R0112:Slco1b2 UTSW 6 141671111 missense probably benign 0.30
R0116:Slco1b2 UTSW 6 141669388 missense probably benign 0.22
R0515:Slco1b2 UTSW 6 141669410 missense possibly damaging 0.74
R0831:Slco1b2 UTSW 6 141685446 missense probably benign 0.01
R1115:Slco1b2 UTSW 6 141683254 missense probably benign 0.03
R1452:Slco1b2 UTSW 6 141672200 missense probably benign 0.02
R1630:Slco1b2 UTSW 6 141656821 missense probably damaging 0.99
R1885:Slco1b2 UTSW 6 141683225 missense probably damaging 0.96
R1886:Slco1b2 UTSW 6 141683225 missense probably damaging 0.96
R1975:Slco1b2 UTSW 6 141683225 missense probably damaging 0.96
R2394:Slco1b2 UTSW 6 141669374 missense probably damaging 0.99
R3408:Slco1b2 UTSW 6 141676256 missense probably benign 0.01
R3793:Slco1b2 UTSW 6 141676307 missense probably damaging 1.00
R4560:Slco1b2 UTSW 6 141671167 missense probably benign 0.15
R4561:Slco1b2 UTSW 6 141671167 missense probably benign 0.15
R4563:Slco1b2 UTSW 6 141671167 missense probably benign 0.15
R4807:Slco1b2 UTSW 6 141669469 missense probably damaging 1.00
R4820:Slco1b2 UTSW 6 141685432 missense probably benign 0.05
R4861:Slco1b2 UTSW 6 141671222 missense possibly damaging 0.95
R4861:Slco1b2 UTSW 6 141671222 missense possibly damaging 0.95
R4889:Slco1b2 UTSW 6 141656743 intron probably benign
R4914:Slco1b2 UTSW 6 141669370 missense probably benign 0.14
R4918:Slco1b2 UTSW 6 141669370 missense probably benign 0.14
R4977:Slco1b2 UTSW 6 141657557 missense probably benign 0.01
R5607:Slco1b2 UTSW 6 141685586 missense probably benign
R6082:Slco1b2 UTSW 6 141663670 missense probably benign 0.08
R6118:Slco1b2 UTSW 6 141657510 missense probably benign 0.03
R6522:Slco1b2 UTSW 6 141655419 critical splice donor site probably null
R7054:Slco1b2 UTSW 6 141672248 missense probably damaging 1.00
R7182:Slco1b2 UTSW 6 141656930 missense probably damaging 1.00
R7763:Slco1b2 UTSW 6 141676224 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTTCCATCATAAAGAGTCACCCAGAGT -3'
(R):5'- TGCACAGCTAGGCCCTGACAA -3'

Sequencing Primer
(F):5'- CCAGAGATACCTGTTATGAGCTG -3'
(R):5'- TAGGCCCTGACAAGGGTG -3'
Posted On2013-11-08