Incidental Mutation 'R0965:Nfatc4'
ID 81617
Institutional Source Beutler Lab
Gene Symbol Nfatc4
Ensembl Gene ENSMUSG00000023411
Gene Name nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 4
Synonyms 3110041H08Rik
MMRRC Submission 039094-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0965 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 56062252-56071400 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 56064043 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 107 (S107P)
Ref Sequence ENSEMBL: ENSMUSP00000154682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024179] [ENSMUST00000172271] [ENSMUST00000226357] [ENSMUST00000226979]
AlphaFold Q8K120
Predicted Effect probably damaging
Transcript: ENSMUST00000024179
AA Change: S177P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024179
Gene: ENSMUSG00000023411
AA Change: S177P

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
low complexity region 53 82 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
low complexity region 151 190 N/A INTRINSIC
low complexity region 211 224 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
low complexity region 286 312 N/A INTRINSIC
Pfam:RHD_DNA_bind 419 578 3.5e-23 PFAM
IPT 585 684 1.29e-21 SMART
low complexity region 700 711 N/A INTRINSIC
low complexity region 716 726 N/A INTRINSIC
low complexity region 803 825 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172271
AA Change: S177P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132763
Gene: ENSMUSG00000023411
AA Change: S177P

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
low complexity region 53 82 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
low complexity region 151 190 N/A INTRINSIC
low complexity region 211 224 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
low complexity region 286 312 N/A INTRINSIC
Pfam:RHD 419 578 3.4e-23 PFAM
IPT 585 684 1.29e-21 SMART
low complexity region 700 711 N/A INTRINSIC
low complexity region 716 726 N/A INTRINSIC
low complexity region 803 825 N/A INTRINSIC
low complexity region 878 889 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226293
Predicted Effect probably damaging
Transcript: ENSMUST00000226357
AA Change: S107P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226716
Predicted Effect probably benign
Transcript: ENSMUST00000226979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227746
Predicted Effect probably benign
Transcript: ENSMUST00000228308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226869
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nuclear factor of activated T cells (NFAT) protein family. The encoded protein is part of a DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor stimulation and an inducible nuclear component. NFAT proteins are activated by the calmodulin-dependent phosphatase, calcineurin. The encoded protein plays a role in the inducible expression of cytokine genes in T cells, especially in the induction of interleukin-2 and interleukin-4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal and exhibit normal embryonic heart morphology as well as normal pathophysiologic cardiac hypertrophy in response to angiotensin II infusion or aortic banding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 AGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGG 4: 129,886,209 (GRCm39) probably benign Het
Amacr C T 15: 10,984,891 (GRCm39) R170C probably damaging Het
Bcl2 A T 1: 106,640,021 (GRCm39) L197Q probably benign Het
Brd1 G A 15: 88,601,231 (GRCm39) R468W probably damaging Het
Esco1 A G 18: 10,567,570 (GRCm39) F821L probably damaging Het
Gtf3c3 C T 1: 54,456,937 (GRCm39) A488T probably damaging Het
Gzma G A 13: 113,234,868 (GRCm39) P38L probably damaging Het
Mcc A G 18: 44,857,593 (GRCm39) L174P probably benign Het
Med19 A G 2: 84,508,793 (GRCm39) E2G probably damaging Het
Muc5b C T 7: 141,417,539 (GRCm39) T3495I possibly damaging Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Or9g4b A G 2: 85,616,643 (GRCm39) S263G probably damaging Het
Phf11c T A 14: 59,618,931 (GRCm39) I285F probably damaging Het
Prkdc T C 16: 15,647,580 (GRCm39) V3668A probably benign Het
Rbm20 T C 19: 53,847,832 (GRCm39) F1126S probably damaging Het
Slc7a5 T C 8: 122,633,840 (GRCm39) E169G probably benign Het
Slco1b2 C A 6: 141,631,322 (GRCm39) T652K probably damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Tmem119 A C 5: 113,933,480 (GRCm39) V107G probably damaging Het
Ttn C A 2: 76,629,915 (GRCm39) G14205V probably damaging Het
Zc3h11a T C 1: 133,573,541 (GRCm39) N33S possibly damaging Het
Other mutations in Nfatc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Nfatc4 APN 14 56,070,019 (GRCm39) missense probably damaging 1.00
IGL01295:Nfatc4 APN 14 56,069,962 (GRCm39) missense probably benign 0.03
IGL01791:Nfatc4 APN 14 56,069,695 (GRCm39) missense probably null 0.04
IGL02536:Nfatc4 APN 14 56,067,367 (GRCm39) missense probably damaging 1.00
R0448:Nfatc4 UTSW 14 56,069,111 (GRCm39) missense possibly damaging 0.90
R0571:Nfatc4 UTSW 14 56,067,485 (GRCm39) missense probably damaging 0.96
R0743:Nfatc4 UTSW 14 56,064,101 (GRCm39) missense probably damaging 1.00
R0884:Nfatc4 UTSW 14 56,064,101 (GRCm39) missense probably damaging 1.00
R1141:Nfatc4 UTSW 14 56,070,088 (GRCm39) missense probably damaging 1.00
R2309:Nfatc4 UTSW 14 56,064,461 (GRCm39) missense probably damaging 1.00
R2680:Nfatc4 UTSW 14 56,070,291 (GRCm39) unclassified probably benign
R4200:Nfatc4 UTSW 14 56,069,489 (GRCm39) missense probably damaging 1.00
R4905:Nfatc4 UTSW 14 56,068,039 (GRCm39) missense probably benign 0.16
R5067:Nfatc4 UTSW 14 56,069,875 (GRCm39) missense probably damaging 0.98
R5202:Nfatc4 UTSW 14 56,064,116 (GRCm39) missense probably damaging 1.00
R5415:Nfatc4 UTSW 14 56,070,091 (GRCm39) missense probably benign
R5585:Nfatc4 UTSW 14 56,064,212 (GRCm39) missense probably damaging 0.98
R5599:Nfatc4 UTSW 14 56,069,733 (GRCm39) missense probably benign 0.02
R6030:Nfatc4 UTSW 14 56,069,897 (GRCm39) nonsense probably null
R6030:Nfatc4 UTSW 14 56,069,897 (GRCm39) nonsense probably null
R6172:Nfatc4 UTSW 14 56,066,990 (GRCm39) missense possibly damaging 0.83
R7292:Nfatc4 UTSW 14 56,062,512 (GRCm39) missense probably damaging 1.00
R7473:Nfatc4 UTSW 14 56,069,421 (GRCm39) missense probably benign 0.19
R7738:Nfatc4 UTSW 14 56,069,414 (GRCm39) missense possibly damaging 0.83
R8309:Nfatc4 UTSW 14 56,063,848 (GRCm39) missense probably damaging 0.99
R8445:Nfatc4 UTSW 14 56,063,875 (GRCm39) missense possibly damaging 0.85
R8853:Nfatc4 UTSW 14 56,063,690 (GRCm39) missense probably damaging 0.98
R9177:Nfatc4 UTSW 14 56,064,685 (GRCm39) missense probably damaging 1.00
R9268:Nfatc4 UTSW 14 56,064,685 (GRCm39) missense probably damaging 1.00
R9553:Nfatc4 UTSW 14 56,070,259 (GRCm39) missense probably damaging 1.00
R9667:Nfatc4 UTSW 14 56,066,964 (GRCm39) missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- GTGTTCTTGAGTGTCCCAGCATCC -3'
(R):5'- CTCGCTAGAAGTCCTCCGAGTTTTC -3'

Sequencing Primer
(F):5'- CGGATTACCTCCATCTCTCCC -3'
(R):5'- AGGAGTAGCCAGCTATCCTCTG -3'
Posted On 2013-11-08