Incidental Mutation 'R0965:Phf11c'
ID81618
Institutional Source Beutler Lab
Gene Symbol Phf11c
Ensembl Gene ENSMUSG00000091144
Gene NamePHD finger protein 11C
SynonymsGm6907
MMRRC Submission 039094-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0965 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location59380833-59395381 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59381482 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 285 (I285F)
Ref Sequence ENSEMBL: ENSMUSP00000131536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166912]
Predicted Effect probably damaging
Transcript: ENSMUST00000166912
AA Change: I285F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131536
Gene: ENSMUSG00000091144
AA Change: I285F

DomainStartEndE-ValueType
PHD 112 162 3.25e-4 SMART
low complexity region 178 186 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 AGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGG 4: 129,992,416 probably benign Het
Amacr C T 15: 10,984,805 R170C probably damaging Het
Bcl2 A T 1: 106,712,291 L197Q probably benign Het
Brd1 G A 15: 88,717,028 R468W probably damaging Het
Esco1 A G 18: 10,567,570 F821L probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Gzma G A 13: 113,098,334 P38L probably damaging Het
Mcc A G 18: 44,724,526 L174P probably benign Het
Med19 A G 2: 84,678,449 E2G probably damaging Het
Muc5b C T 7: 141,863,802 T3495I possibly damaging Het
Nfatc4 T C 14: 55,826,586 S107P probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1015 A G 2: 85,786,299 S263G probably damaging Het
Prkdc T C 16: 15,829,716 V3668A probably benign Het
Rbm20 T C 19: 53,859,401 F1126S probably damaging Het
Slc7a5 T C 8: 121,907,101 E169G probably benign Het
Slco1b2 C A 6: 141,685,596 T652K probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tmem119 A C 5: 113,795,419 V107G probably damaging Het
Ttn C A 2: 76,799,571 G14205V probably damaging Het
Zc3h11a T C 1: 133,645,803 N33S possibly damaging Het
Other mutations in Phf11c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Phf11c APN 14 59389348 missense probably benign 0.07
IGL01080:Phf11c APN 14 59393199 missense probably benign 0.00
IGL01819:Phf11c APN 14 59393137 missense probably benign 0.00
IGL02691:Phf11c APN 14 59384787 missense probably damaging 1.00
R0029:Phf11c UTSW 14 59384915 missense probably benign 0.02
R3001:Phf11c UTSW 14 59384840 missense probably damaging 1.00
R3002:Phf11c UTSW 14 59384840 missense probably damaging 1.00
R3081:Phf11c UTSW 14 59381484 missense probably benign
R4230:Phf11c UTSW 14 59393067 missense probably benign 0.00
R4432:Phf11c UTSW 14 59390935 missense possibly damaging 0.67
R5649:Phf11c UTSW 14 59385532 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACAGTCTGTCTCCTGAGTCTGCTTG -3'
(R):5'- CAATGTCCTTGGAGCCAGAGATGTG -3'

Sequencing Primer
(F):5'- TGCTTGCACTTCAGGAGAC -3'
(R):5'- TCTTGTCCTACAGTGAAGGAGAAC -3'
Posted On2013-11-08