Incidental Mutation 'R0965:Esco1'
ID81622
Institutional Source Beutler Lab
Gene Symbol Esco1
Ensembl Gene ENSMUSG00000024293
Gene Nameestablishment of sister chromatid cohesion N-acetyltransferase 1
SynonymsA930014I12Rik
MMRRC Submission 039094-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R0965 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location10566602-10610352 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10567570 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 821 (F821L)
Ref Sequence ENSEMBL: ENSMUSP00000025142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025142] [ENSMUST00000048977] [ENSMUST00000097670] [ENSMUST00000115864]
Predicted Effect probably damaging
Transcript: ENSMUST00000025142
AA Change: F821L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025142
Gene: ENSMUSG00000024293
AA Change: F821L

DomainStartEndE-ValueType
coiled coil region 8 32 N/A INTRINSIC
low complexity region 117 128 N/A INTRINSIC
low complexity region 322 338 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
Pfam:zf-C2H2_3 607 646 4.7e-17 PFAM
Pfam:Acetyltransf_13 766 834 1.3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048977
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097670
AA Change: F322L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095274
Gene: ENSMUSG00000024293
AA Change: F322L

DomainStartEndE-ValueType
Pfam:zf-C2H2_3 108 148 1.7e-19 PFAM
Pfam:Acetyltransf_13 266 335 4.6e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115864
AA Change: F297L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111530
Gene: ENSMUSG00000024293
AA Change: F297L

DomainStartEndE-ValueType
Pfam:zf-C2H2_3 83 123 1.8e-19 PFAM
Pfam:Acetyltransf_13 241 310 4.1e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145320
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ESCO1 belongs to a conserved family of acetyltransferases involved in sister chromatid cohesion (Hou and Zou, 2005 [PubMed 15958495]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 AGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGG 4: 129,992,416 probably benign Het
Amacr C T 15: 10,984,805 R170C probably damaging Het
Bcl2 A T 1: 106,712,291 L197Q probably benign Het
Brd1 G A 15: 88,717,028 R468W probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Gzma G A 13: 113,098,334 P38L probably damaging Het
Mcc A G 18: 44,724,526 L174P probably benign Het
Med19 A G 2: 84,678,449 E2G probably damaging Het
Muc5b C T 7: 141,863,802 T3495I possibly damaging Het
Nfatc4 T C 14: 55,826,586 S107P probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1015 A G 2: 85,786,299 S263G probably damaging Het
Phf11c T A 14: 59,381,482 I285F probably damaging Het
Prkdc T C 16: 15,829,716 V3668A probably benign Het
Rbm20 T C 19: 53,859,401 F1126S probably damaging Het
Slc7a5 T C 8: 121,907,101 E169G probably benign Het
Slco1b2 C A 6: 141,685,596 T652K probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tmem119 A C 5: 113,795,419 V107G probably damaging Het
Ttn C A 2: 76,799,571 G14205V probably damaging Het
Zc3h11a T C 1: 133,645,803 N33S possibly damaging Het
Other mutations in Esco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Esco1 APN 18 10582078 missense probably damaging 1.00
IGL01376:Esco1 APN 18 10594892 nonsense probably null
IGL01886:Esco1 APN 18 10595262 missense probably damaging 1.00
IGL03171:Esco1 APN 18 10594263 missense probably damaging 1.00
IGL03233:Esco1 APN 18 10574877 missense probably damaging 1.00
PIT4576001:Esco1 UTSW 18 10572093 missense probably damaging 1.00
PIT4585001:Esco1 UTSW 18 10594355 nonsense probably null
R0266:Esco1 UTSW 18 10594605 missense probably benign 0.00
R0445:Esco1 UTSW 18 10574989 missense probably damaging 1.00
R0494:Esco1 UTSW 18 10594940 missense probably benign 0.28
R1834:Esco1 UTSW 18 10594350 missense probably damaging 1.00
R2140:Esco1 UTSW 18 10574873 critical splice donor site probably null
R2141:Esco1 UTSW 18 10574873 critical splice donor site probably null
R2142:Esco1 UTSW 18 10574873 critical splice donor site probably null
R4562:Esco1 UTSW 18 10595074 missense possibly damaging 0.74
R4668:Esco1 UTSW 18 10594734 missense possibly damaging 0.60
R5083:Esco1 UTSW 18 10594734 missense probably benign 0.00
R5128:Esco1 UTSW 18 10567468 utr 3 prime probably benign
R5407:Esco1 UTSW 18 10574886 missense probably damaging 1.00
R5454:Esco1 UTSW 18 10584327 missense probably benign
R5870:Esco1 UTSW 18 10593744 critical splice donor site probably null
R5965:Esco1 UTSW 18 10593867 missense possibly damaging 0.94
R6360:Esco1 UTSW 18 10574931 missense probably damaging 1.00
R6390:Esco1 UTSW 18 10567528 missense probably damaging 1.00
R6438:Esco1 UTSW 18 10572031 missense probably damaging 1.00
R6524:Esco1 UTSW 18 10582188 critical splice acceptor site probably null
R6534:Esco1 UTSW 18 10594794 missense possibly damaging 0.90
R6633:Esco1 UTSW 18 10595738 intron probably benign
Predicted Primers PCR Primer
(F):5'- CCTAGTTCCTGGATAAAGTCAGCAACC -3'
(R):5'- TGAGAAACAGTCCGGTCTTTTACTGC -3'

Sequencing Primer
(F):5'- TGGATAAAGTCAGCAACCAATTC -3'
(R):5'- GGCTCATATTTGAGTAAAG -3'
Posted On2013-11-08