Incidental Mutation 'R0965:Rbm20'
ID81625
Institutional Source Beutler Lab
Gene Symbol Rbm20
Ensembl Gene ENSMUSG00000043639
Gene NameRNA binding motif protein 20
Synonyms2010003H22Rik, 1110018J23Rik
MMRRC Submission 039094-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R0965 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location53677306-53867080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53859401 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 1126 (F1126S)
Ref Sequence ENSEMBL: ENSMUSP00000129447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164202]
Predicted Effect probably benign
Transcript: ENSMUST00000161856
SMART Domains Protein: ENSMUSP00000124363
Gene: ENSMUSG00000043639

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
low complexity region 180 191 N/A INTRINSIC
low complexity region 209 220 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164202
AA Change: F1126S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129447
Gene: ENSMUSG00000043639
AA Change: F1126S

DomainStartEndE-ValueType
low complexity region 25 61 N/A INTRINSIC
low complexity region 106 117 N/A INTRINSIC
low complexity region 170 183 N/A INTRINSIC
low complexity region 251 260 N/A INTRINSIC
ZnF_U1 410 444 6.79e-1 SMART
ZnF_C2H2 413 437 4.69e0 SMART
RRM 521 591 4.01e-5 SMART
low complexity region 634 657 N/A INTRINSIC
low complexity region 804 815 N/A INTRINSIC
low complexity region 833 844 N/A INTRINSIC
ZnF_U1 1130 1165 7.26e-6 SMART
ZnF_C2H2 1133 1158 3.13e1 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds RNA and regulates splicing. Mutations in this gene have been associated with familial dilated cardiomyopathy. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for an allele lacking the RNA recognition motif exhibit increased titin compliance, and attenuated Frank-Starling mechanism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 AGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGG 4: 129,992,416 probably benign Het
Amacr C T 15: 10,984,805 R170C probably damaging Het
Bcl2 A T 1: 106,712,291 L197Q probably benign Het
Brd1 G A 15: 88,717,028 R468W probably damaging Het
Esco1 A G 18: 10,567,570 F821L probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Gzma G A 13: 113,098,334 P38L probably damaging Het
Mcc A G 18: 44,724,526 L174P probably benign Het
Med19 A G 2: 84,678,449 E2G probably damaging Het
Muc5b C T 7: 141,863,802 T3495I possibly damaging Het
Nfatc4 T C 14: 55,826,586 S107P probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1015 A G 2: 85,786,299 S263G probably damaging Het
Phf11c T A 14: 59,381,482 I285F probably damaging Het
Prkdc T C 16: 15,829,716 V3668A probably benign Het
Slc7a5 T C 8: 121,907,101 E169G probably benign Het
Slco1b2 C A 6: 141,685,596 T652K probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tmem119 A C 5: 113,795,419 V107G probably damaging Het
Ttn C A 2: 76,799,571 G14205V probably damaging Het
Zc3h11a T C 1: 133,645,803 N33S possibly damaging Het
Other mutations in Rbm20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rbm20 APN 19 53843264 missense probably damaging 1.00
IGL00815:Rbm20 APN 19 53815517 missense probably damaging 1.00
IGL00845:Rbm20 APN 19 53817949 missense probably damaging 1.00
IGL01408:Rbm20 APN 19 53851613 missense possibly damaging 0.95
IGL01663:Rbm20 APN 19 53840995 missense probably damaging 1.00
IGL01902:Rbm20 APN 19 53840991 missense probably damaging 0.99
IGL01942:Rbm20 APN 19 53813443 missense probably damaging 1.00
IGL02964:Rbm20 APN 19 53813702 missense probably benign 0.02
IGL03326:Rbm20 APN 19 53814000 missense possibly damaging 0.85
BB001:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
BB002:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
BB011:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
BB012:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
R0326:Rbm20 UTSW 19 53864165 missense probably damaging 1.00
R0487:Rbm20 UTSW 19 53851195 missense probably damaging 1.00
R1435:Rbm20 UTSW 19 53814157 missense probably benign 0.16
R1914:Rbm20 UTSW 19 53864087 missense probably damaging 1.00
R1915:Rbm20 UTSW 19 53864087 missense probably damaging 1.00
R2011:Rbm20 UTSW 19 53859428 missense probably damaging 1.00
R2012:Rbm20 UTSW 19 53859428 missense probably damaging 1.00
R2258:Rbm20 UTSW 19 53851741 missense probably benign
R3947:Rbm20 UTSW 19 53813337 missense probably benign 0.35
R4305:Rbm20 UTSW 19 53843260 missense probably damaging 1.00
R4308:Rbm20 UTSW 19 53843260 missense probably damaging 1.00
R4521:Rbm20 UTSW 19 53817202 missense probably benign 0.14
R4970:Rbm20 UTSW 19 53851669 missense probably damaging 0.99
R5266:Rbm20 UTSW 19 53813387 missense probably damaging 1.00
R5475:Rbm20 UTSW 19 53834705 nonsense probably null
R5503:Rbm20 UTSW 19 53851354 missense possibly damaging 0.75
R5995:Rbm20 UTSW 19 53851267 missense possibly damaging 0.95
R6836:Rbm20 UTSW 19 53814069 missense probably damaging 0.98
R6947:Rbm20 UTSW 19 53851265 missense probably damaging 1.00
R7030:Rbm20 UTSW 19 53834766 missense probably damaging 1.00
R7117:Rbm20 UTSW 19 53851558 missense possibly damaging 0.92
R7237:Rbm20 UTSW 19 53851499 missense probably benign 0.04
R7638:Rbm20 UTSW 19 53814333 missense possibly damaging 0.95
R7792:Rbm20 UTSW 19 53850136 missense probably benign
R7823:Rbm20 UTSW 19 53843354 missense probably benign 0.33
R7924:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
R7925:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
R8044:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8045:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8046:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8100:Rbm20 UTSW 19 53851313 missense possibly damaging 0.85
R8292:Rbm20 UTSW 19 53851499 missense possibly damaging 0.71
R8366:Rbm20 UTSW 19 53850181 missense possibly damaging 0.95
R8518:Rbm20 UTSW 19 53851492 missense probably benign 0.18
RF016:Rbm20 UTSW 19 53813732 missense probably benign 0.00
Z1177:Rbm20 UTSW 19 53851685 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGACCCACACATGAAAGGCAG -3'
(R):5'- TGTGACTGAAGGCTGGAAGACCTC -3'

Sequencing Primer
(F):5'- ACAGCCACCTGTGAATGG -3'
(R):5'- GCTGGAAGACCTCATGGTG -3'
Posted On2013-11-08