Mutagenetix > Incidental Mutation

Incidental Mutation 'R0870:Rasip1'

81628

Institutional Source

Beutler Lab

Gene Symbol

Rasip1

Ensembl Gene

ENSMUSG00000044562

Gene Name

Ras interacting protein 1

Synonyms

Rain, 2610025P08Rik

MMRRC Submission

039042-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0870 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

45276961-45288516 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 45284452 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 639 (P639S)

Ref Sequence

ENSEMBL: ENSMUSP00000062429 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057927] [ENSMUST00000148532]

AlphaFold

Q3U0S6

Predicted Effect

probably damaging
Transcript: ENSMUST00000057927
AA Change: P639S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000062429
Gene: ENSMUSG00000044562
AA Change: P639S

Domain	Start	End	E-Value	Type
low complexity region	41	57	N/A	INTRINSIC
low complexity region	59	67	N/A	INTRINSIC
low complexity region	72	90	N/A	INTRINSIC
low complexity region	97	112	N/A	INTRINSIC
RA	141	253	6.94e-8	SMART
low complexity region	284	308	N/A	INTRINSIC
low complexity region	310	326	N/A	INTRINSIC
low complexity region	327	339	N/A	INTRINSIC
SCOP:d1gxca_	391	484	1e-2	SMART
low complexity region	498	509	N/A	INTRINSIC
low complexity region	556	575	N/A	INTRINSIC
low complexity region	679	692	N/A	INTRINSIC
DIL	768	877	4.14e-44	SMART
low complexity region	928	947	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148532

SMART Domains

Protein: ENSMUSP00000114686
Gene: ENSMUSG00000042918

Domain	Start	End	E-Value	Type
low complexity region	45	56	N/A	INTRINSIC
low complexity region	143	155	N/A	INTRINSIC
SAP	165	199	1.3e-7	SMART
low complexity region	200	213	N/A	INTRINSIC
low complexity region	255	297	N/A	INTRINSIC
low complexity region	320	336	N/A	INTRINSIC
low complexity region	347	372	N/A	INTRINSIC
low complexity region	385	399	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209998

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210213

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210648

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211418

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211533

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.2%
20x: 94.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a targeted mutation exhibit complete embryonic lethality during organogenesis associated with a failure in cardiovascular development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 5 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	GCC	GC	13: 59,839,412 (GRCm39)		probably null	Het
Fam83e	G	A	7: 45,376,135 (GRCm39)	E283K	probably damaging	Het
Fat2	A	T	11: 55,202,601 (GRCm39)	S158T	probably benign	Het
Pum1	A	G	4: 130,496,155 (GRCm39)	H963R	probably damaging	Het
Thsd7a	A	G	6: 12,337,273 (GRCm39)	V1248A	probably damaging	Het

Other mutations in Rasip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01958:Rasip1	APN	7	45,286,188 (GRCm39)	nonsense	probably null
IGL01995:Rasip1	APN	7	45,286,240 (GRCm39)	missense	probably damaging	0.99
R0208:Rasip1	UTSW	7	45,281,999 (GRCm39)	missense	probably damaging	0.97
R0373:Rasip1	UTSW	7	45,284,668 (GRCm39)	missense	possibly damaging	0.50
R0869:Rasip1	UTSW	7	45,284,452 (GRCm39)	missense	probably damaging	0.99
R0871:Rasip1	UTSW	7	45,284,452 (GRCm39)	missense	probably damaging	0.99
R0872:Rasip1	UTSW	7	45,284,452 (GRCm39)	missense	probably damaging	0.99
R1388:Rasip1	UTSW	7	45,279,656 (GRCm39)	missense	probably damaging	0.98
R1780:Rasip1	UTSW	7	45,284,742 (GRCm39)	missense	possibly damaging	0.94
R2348:Rasip1	UTSW	7	45,278,507 (GRCm39)	critical splice donor site	probably null
R2517:Rasip1	UTSW	7	45,284,247 (GRCm39)	missense	probably damaging	1.00
R4587:Rasip1	UTSW	7	45,282,159 (GRCm39)	missense	possibly damaging	0.86
R4678:Rasip1	UTSW	7	45,277,247 (GRCm39)	missense	possibly damaging	0.86
R4679:Rasip1	UTSW	7	45,277,247 (GRCm39)	missense	possibly damaging	0.86
R4714:Rasip1	UTSW	7	45,281,820 (GRCm39)	frame shift	probably null
R5572:Rasip1	UTSW	7	45,286,153 (GRCm39)	missense	probably benign	0.00
R6182:Rasip1	UTSW	7	45,277,879 (GRCm39)	small deletion	probably benign
R7443:Rasip1	UTSW	7	45,288,148 (GRCm39)	missense	probably damaging	1.00
R7769:Rasip1	UTSW	7	45,278,239 (GRCm39)	missense	probably damaging	0.98
R8146:Rasip1	UTSW	7	45,279,704 (GRCm39)	missense	possibly damaging	0.95
R8158:Rasip1	UTSW	7	45,281,943 (GRCm39)	missense	probably damaging	1.00
R8493:Rasip1	UTSW	7	45,284,467 (GRCm39)	missense	possibly damaging	0.89
R9047:Rasip1	UTSW	7	45,282,066 (GRCm39)	missense	possibly damaging	0.52
R9352:Rasip1	UTSW	7	45,278,280 (GRCm39)	missense	possibly damaging	0.69
R9679:Rasip1	UTSW	7	45,277,327 (GRCm39)	missense	possibly damaging	0.85
X0018:Rasip1	UTSW	7	45,288,292 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AAGAAATTGGAGACCGCCAGCC -3'
(R):5'- GTATTTCAGGAGGGAAGCGTCACC -3'

Sequencing Primer
(F):5'- CCGCCAGCCAGAGAAGTAAG -3'
(R):5'- TCCAAGTCATTGCAGAGCTG -3'

Posted On

2013-11-08