Mutagenetix > Incidental Mutation

Incidental Mutation 'R0873:Thsd7a'

81642

Institutional Source

Beutler Lab

Gene Symbol

Thsd7a

Ensembl Gene

ENSMUSG00000032625

Gene Name

thrombospondin, type I, domain containing 7A

Synonyms

LOC330267

MMRRC Submission

039045-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0873 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12311607-12749252 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12337273 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1248 (V1248A)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119581] [ENSMUST00000172356]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000046121
AA Change: V1248A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000040176
Gene: ENSMUSG00000032625
AA Change: V1248A

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1084	1.2e-7	SMART
TSP1	1087	1152	5.82e-1	SMART
TSP1	1157	1209	4.24e-2	SMART
TSP1	1212	1273	1e0	SMART
TSP1	1278	1330	3.55e-10	SMART
TSP1	1331	1401	7.5e-2	SMART
TSP1	1406	1464	1.55e-1	SMART
transmembrane domain	1596	1618	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000119581
AA Change: V1248A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000113681
Gene: ENSMUSG00000032625
AA Change: V1248A

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1082	9.09e-8	SMART
TSP1	1085	1150	5.82e-1	SMART
TSP1	1155	1207	4.24e-2	SMART
TSP1	1210	1271	1e0	SMART
TSP1	1276	1328	3.55e-10	SMART
TSP1	1329	1399	7.5e-2	SMART
TSP1	1404	1462	1.55e-1	SMART
transmembrane domain	1594	1616	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122369

SMART Domains

Protein: ENSMUSP00000112503
Gene: ENSMUSG00000032625

Domain	Start	End	E-Value	Type
TSP1	43	100	6.24e-6	SMART
TSP1	178	228	7.31e-2	SMART
Blast:TSP1	232	302	4e-26	BLAST
TSP1	307	362	9.09e-8	SMART
TSP1	365	430	5.82e-1	SMART
TSP1	435	487	4.24e-2	SMART
TSP1	490	551	1e0	SMART
TSP1	556	608	3.55e-10	SMART
TSP1	609	679	7.5e-2	SMART
TSP1	684	742	1.55e-1	SMART
transmembrane domain	874	896	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000172356
AA Change: V1248A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131662
Gene: ENSMUSG00000032625
AA Change: V1248A

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1084	1.95e-7	SMART
TSP1	1087	1152	5.82e-1	SMART
TSP1	1157	1209	4.24e-2	SMART
TSP1	1212	1273	1e0	SMART
TSP1	1278	1330	3.55e-10	SMART
TSP1	1331	1401	7.5e-2	SMART
TSP1	1406	1464	1.55e-1	SMART
transmembrane domain	1596	1618	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.7%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found almost exclusively in endothelial cells from placenta and umbilical cord. The encoded protein appears to interact with alpha(V)beta(3) integrin and paxillin to inhibit endothelial cell migration and tube formation. This protein may be involved in cytoskeletal organization. Variations in this gene may be associated with low bone mineral density in osteoporosis. [provided by RefSeq, Aug 2010]

Allele List at MGI

Other mutations in this stock

Total: 2 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	GCC	GC	13: 59,839,412 (GRCm39)		probably null	Het
Arvcf	C	T	16: 18,218,955 (GRCm39)	R545*	probably null	Het

Other mutations in Thsd7a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00562:Thsd7a	APN	6	12,379,658 (GRCm39)	splice site	probably null
IGL00563:Thsd7a	APN	6	12,379,658 (GRCm39)	splice site	probably null
IGL00753:Thsd7a	APN	6	12,327,528 (GRCm39)	missense	probably damaging	1.00
IGL00835:Thsd7a	APN	6	12,554,933 (GRCm39)	missense	probably damaging	1.00
IGL01486:Thsd7a	APN	6	12,471,079 (GRCm39)	missense	probably damaging	1.00
IGL01730:Thsd7a	APN	6	12,554,980 (GRCm39)	missense	probably benign	0.05
IGL01931:Thsd7a	APN	6	12,504,098 (GRCm39)	missense	probably damaging	1.00
IGL01935:Thsd7a	APN	6	12,317,418 (GRCm39)	missense	probably damaging	1.00
IGL01978:Thsd7a	APN	6	12,331,005 (GRCm39)	missense	probably benign	0.01
IGL02233:Thsd7a	APN	6	12,555,257 (GRCm39)	missense	probably benign	0.00
IGL02354:Thsd7a	APN	6	12,348,192 (GRCm39)	splice site	probably benign
IGL02361:Thsd7a	APN	6	12,348,192 (GRCm39)	splice site	probably benign
IGL02375:Thsd7a	APN	6	12,343,264 (GRCm39)	missense	probably damaging	1.00
IGL02468:Thsd7a	APN	6	12,318,170 (GRCm39)	missense	probably damaging	0.98
IGL02616:Thsd7a	APN	6	12,408,984 (GRCm39)	missense	probably damaging	0.98
IGL02820:Thsd7a	APN	6	12,321,071 (GRCm39)	missense	probably damaging	1.00
IGL02858:Thsd7a	APN	6	12,500,994 (GRCm39)	missense	probably benign	0.16
IGL03074:Thsd7a	APN	6	12,324,680 (GRCm39)	missense	probably damaging	0.99
IGL03234:Thsd7a	APN	6	12,343,177 (GRCm39)	missense	probably damaging	1.00
IGL03244:Thsd7a	APN	6	12,504,167 (GRCm39)	splice site	probably benign
IGL03337:Thsd7a	APN	6	12,405,173 (GRCm39)	missense	probably damaging	1.00
G1patch:Thsd7a	UTSW	6	12,555,630 (GRCm39)	missense	possibly damaging	0.87
PIT4354001:Thsd7a	UTSW	6	12,331,926 (GRCm39)	critical splice donor site	probably null
R0095:Thsd7a	UTSW	6	12,320,969 (GRCm39)	missense	probably damaging	0.99
R0127:Thsd7a	UTSW	6	12,554,907 (GRCm39)	missense	probably benign	0.01
R0142:Thsd7a	UTSW	6	12,418,334 (GRCm39)	missense	probably damaging	1.00
R0226:Thsd7a	UTSW	6	12,321,899 (GRCm39)	missense	possibly damaging	0.94
R0242:Thsd7a	UTSW	6	12,503,915 (GRCm39)	missense	probably benign	0.32
R0242:Thsd7a	UTSW	6	12,503,915 (GRCm39)	missense	probably benign	0.32
R0359:Thsd7a	UTSW	6	12,352,030 (GRCm39)	missense	probably damaging	1.00
R0365:Thsd7a	UTSW	6	12,321,886 (GRCm39)	critical splice donor site	probably null
R0504:Thsd7a	UTSW	6	12,379,593 (GRCm39)	missense	probably damaging	0.99
R0512:Thsd7a	UTSW	6	12,379,604 (GRCm39)	missense	possibly damaging	0.67
R0540:Thsd7a	UTSW	6	12,331,541 (GRCm39)	splice site	probably null
R0577:Thsd7a	UTSW	6	12,321,047 (GRCm39)	missense	possibly damaging	0.50
R0607:Thsd7a	UTSW	6	12,331,541 (GRCm39)	splice site	probably null
R0755:Thsd7a	UTSW	6	12,555,368 (GRCm39)	missense	probably damaging	1.00
R0771:Thsd7a	UTSW	6	12,327,576 (GRCm39)	missense	probably benign	0.09
R0780:Thsd7a	UTSW	6	12,337,273 (GRCm39)	missense	probably damaging	1.00
R0870:Thsd7a	UTSW	6	12,337,273 (GRCm39)	missense	probably damaging	1.00
R0871:Thsd7a	UTSW	6	12,337,273 (GRCm39)	missense	probably damaging	1.00
R0872:Thsd7a	UTSW	6	12,337,273 (GRCm39)	missense	probably damaging	1.00
R1102:Thsd7a	UTSW	6	12,555,701 (GRCm39)	missense	possibly damaging	0.58
R1144:Thsd7a	UTSW	6	12,471,026 (GRCm39)	splice site	probably benign
R1265:Thsd7a	UTSW	6	12,317,418 (GRCm39)	missense	probably damaging	0.99
R1276:Thsd7a	UTSW	6	12,418,369 (GRCm39)	missense	probably damaging	1.00
R1381:Thsd7a	UTSW	6	12,555,438 (GRCm39)	missense	probably damaging	1.00
R1473:Thsd7a	UTSW	6	12,338,621 (GRCm39)	missense	probably benign	0.08
R1519:Thsd7a	UTSW	6	12,471,174 (GRCm39)	missense	probably benign	0.01
R1633:Thsd7a	UTSW	6	12,471,103 (GRCm39)	nonsense	probably null
R1659:Thsd7a	UTSW	6	12,504,063 (GRCm39)	missense	possibly damaging	0.73
R1769:Thsd7a	UTSW	6	12,555,714 (GRCm39)	nonsense	probably null
R1824:Thsd7a	UTSW	6	12,409,041 (GRCm39)	splice site	probably null
R1840:Thsd7a	UTSW	6	12,330,973 (GRCm39)	missense	probably benign	0.03
R1845:Thsd7a	UTSW	6	12,321,040 (GRCm39)	missense	probably damaging	1.00
R1874:Thsd7a	UTSW	6	12,555,434 (GRCm39)	missense	possibly damaging	0.76
R2023:Thsd7a	UTSW	6	12,327,535 (GRCm39)	missense	probably benign	0.16
R2039:Thsd7a	UTSW	6	12,408,922 (GRCm39)	missense	possibly damaging	0.77
R2058:Thsd7a	UTSW	6	12,318,105 (GRCm39)	splice site	probably benign
R2138:Thsd7a	UTSW	6	12,471,072 (GRCm39)	nonsense	probably null
R2155:Thsd7a	UTSW	6	12,379,632 (GRCm39)	missense	probably damaging	1.00
R2175:Thsd7a	UTSW	6	12,331,943 (GRCm39)	missense	possibly damaging	0.95
R2216:Thsd7a	UTSW	6	12,337,267 (GRCm39)	missense	possibly damaging	0.95
R2318:Thsd7a	UTSW	6	12,405,146 (GRCm39)	missense	probably damaging	1.00
R2375:Thsd7a	UTSW	6	12,337,361 (GRCm39)	missense	probably damaging	1.00
R3857:Thsd7a	UTSW	6	12,555,225 (GRCm39)	missense	probably benign	0.15
R3858:Thsd7a	UTSW	6	12,555,225 (GRCm39)	missense	probably benign	0.15
R3890:Thsd7a	UTSW	6	12,418,336 (GRCm39)	missense	probably benign	0.09
R3910:Thsd7a	UTSW	6	12,331,548 (GRCm39)	missense	probably damaging	0.96
R3933:Thsd7a	UTSW	6	12,555,225 (GRCm39)	missense	probably benign	0.15
R4369:Thsd7a	UTSW	6	12,468,907 (GRCm39)	missense	probably damaging	1.00
R4447:Thsd7a	UTSW	6	12,324,634 (GRCm39)	missense	probably damaging	0.98
R4664:Thsd7a	UTSW	6	12,504,012 (GRCm39)	missense	possibly damaging	0.90
R4664:Thsd7a	UTSW	6	12,337,313 (GRCm39)	missense	possibly damaging	0.79
R4665:Thsd7a	UTSW	6	12,504,012 (GRCm39)	missense	possibly damaging	0.90
R4665:Thsd7a	UTSW	6	12,337,313 (GRCm39)	missense	possibly damaging	0.79
R4666:Thsd7a	UTSW	6	12,504,012 (GRCm39)	missense	possibly damaging	0.90
R4666:Thsd7a	UTSW	6	12,337,313 (GRCm39)	missense	possibly damaging	0.79
R4668:Thsd7a	UTSW	6	12,408,967 (GRCm39)	missense	probably damaging	0.98
R4886:Thsd7a	UTSW	6	12,327,659 (GRCm39)	nonsense	probably null
R4918:Thsd7a	UTSW	6	12,327,558 (GRCm39)	missense	probably damaging	1.00
R4938:Thsd7a	UTSW	6	12,330,991 (GRCm39)	missense	probably benign	0.09
R5064:Thsd7a	UTSW	6	12,330,951 (GRCm39)	missense	possibly damaging	0.66
R5153:Thsd7a	UTSW	6	12,338,654 (GRCm39)	missense	probably benign	0.00
R5177:Thsd7a	UTSW	6	12,379,582 (GRCm39)	nonsense	probably null
R5242:Thsd7a	UTSW	6	12,327,582 (GRCm39)	missense	probably damaging	1.00
R5267:Thsd7a	UTSW	6	12,379,601 (GRCm39)	missense	probably damaging	1.00
R5442:Thsd7a	UTSW	6	12,748,799 (GRCm39)	missense	probably benign	0.00
R5506:Thsd7a	UTSW	6	12,332,016 (GRCm39)	missense	possibly damaging	0.85
R5525:Thsd7a	UTSW	6	12,332,006 (GRCm39)	missense	possibly damaging	0.52
R5544:Thsd7a	UTSW	6	12,379,470 (GRCm39)	missense	possibly damaging	0.94
R5651:Thsd7a	UTSW	6	12,343,212 (GRCm39)	missense	probably damaging	1.00
R5716:Thsd7a	UTSW	6	12,343,147 (GRCm39)	missense	probably benign	0.00
R5848:Thsd7a	UTSW	6	12,503,922 (GRCm39)	missense	probably damaging	1.00
R5958:Thsd7a	UTSW	6	12,337,261 (GRCm39)	missense	probably benign	0.02
R6012:Thsd7a	UTSW	6	12,379,388 (GRCm39)	splice site	probably null
R6139:Thsd7a	UTSW	6	12,379,572 (GRCm39)	missense	possibly damaging	0.93
R6243:Thsd7a	UTSW	6	12,327,601 (GRCm39)	missense	probably damaging	1.00
R6257:Thsd7a	UTSW	6	12,408,987 (GRCm39)	nonsense	probably null
R6273:Thsd7a	UTSW	6	12,408,835 (GRCm39)	missense	probably damaging	0.99
R6300:Thsd7a	UTSW	6	12,471,103 (GRCm39)	nonsense	probably null
R6314:Thsd7a	UTSW	6	12,554,996 (GRCm39)	missense	possibly damaging	0.87
R6392:Thsd7a	UTSW	6	12,468,928 (GRCm39)	missense	probably damaging	0.99
R6418:Thsd7a	UTSW	6	12,555,081 (GRCm39)	nonsense	probably null
R6515:Thsd7a	UTSW	6	12,501,085 (GRCm39)	missense	possibly damaging	0.47
R6725:Thsd7a	UTSW	6	12,555,630 (GRCm39)	missense	possibly damaging	0.87
R6742:Thsd7a	UTSW	6	12,408,815 (GRCm39)	missense	probably damaging	1.00
R6776:Thsd7a	UTSW	6	12,555,636 (GRCm39)	missense	possibly damaging	0.53
R6838:Thsd7a	UTSW	6	12,504,074 (GRCm39)	missense	probably damaging	0.99
R7104:Thsd7a	UTSW	6	12,379,429 (GRCm39)	missense
R7170:Thsd7a	UTSW	6	12,352,090 (GRCm39)	missense
R7349:Thsd7a	UTSW	6	12,352,067 (GRCm39)	missense
R7460:Thsd7a	UTSW	6	12,554,933 (GRCm39)	missense
R7467:Thsd7a	UTSW	6	12,331,584 (GRCm39)	missense
R7666:Thsd7a	UTSW	6	12,379,437 (GRCm39)	missense
R7869:Thsd7a	UTSW	6	12,471,123 (GRCm39)	nonsense	probably null
R8032:Thsd7a	UTSW	6	12,555,287 (GRCm39)	missense
R8165:Thsd7a	UTSW	6	12,468,962 (GRCm39)	missense
R8167:Thsd7a	UTSW	6	12,317,400 (GRCm39)	nonsense	probably null
R8245:Thsd7a	UTSW	6	12,379,592 (GRCm39)	missense
R8310:Thsd7a	UTSW	6	12,396,612 (GRCm39)	missense
R8312:Thsd7a	UTSW	6	12,471,181 (GRCm39)	missense
R8331:Thsd7a	UTSW	6	12,471,157 (GRCm39)	missense
R8755:Thsd7a	UTSW	6	12,408,851 (GRCm39)	nonsense	probably null
R8843:Thsd7a	UTSW	6	12,501,136 (GRCm39)	missense
R8867:Thsd7a	UTSW	6	12,338,686 (GRCm39)	missense
R8952:Thsd7a	UTSW	6	12,468,992 (GRCm39)	missense	probably damaging	0.98
R9036:Thsd7a	UTSW	6	12,418,249 (GRCm39)	missense
R9299:Thsd7a	UTSW	6	12,504,131 (GRCm39)	missense
R9366:Thsd7a	UTSW	6	12,555,480 (GRCm39)	missense
R9489:Thsd7a	UTSW	6	12,352,022 (GRCm39)	missense

Predicted Primers

PCR Primer
(F):5'- GCACTAGACAGCCTGTGAAAACAGC -3'
(R):5'- CAAGACTGTCGAGTAGACATCTGCC -3'

Sequencing Primer
(F):5'- AGCTGTTGCCCATGCAAG -3'
(R):5'- GTTCAAATCTGGGACCCATATGC -3'

Posted On

2013-11-08