Incidental Mutation 'R0947:Racgap1'
ID81681
Institutional Source Beutler Lab
Gene Symbol Racgap1
Ensembl Gene ENSMUSG00000023015
Gene NameRac GTPase-activating protein 1
SynonymsBand25, gtl11, GTPase, MgcRacGAP
MMRRC Submission 039086-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0947 (G1)
Quality Score167
Status Not validated
Chromosome15
Chromosomal Location99620496-99651656 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 99624314 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 458 (A458T)
Ref Sequence ENSEMBL: ENSMUSP00000126417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023756] [ENSMUST00000168065] [ENSMUST00000171702]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023756
AA Change: A458T

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023756
Gene: ENSMUSG00000023015
AA Change: A458T

DomainStartEndE-ValueType
coiled coil region 35 110 N/A INTRINSIC
C1 288 336 2.44e-5 SMART
RhoGAP 361 537 3.4e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165745
Predicted Effect probably benign
Transcript: ENSMUST00000168065
SMART Domains Protein: ENSMUSP00000132732
Gene: ENSMUSG00000023015

DomainStartEndE-ValueType
coiled coil region 6 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171017
Predicted Effect possibly damaging
Transcript: ENSMUST00000171702
AA Change: A458T

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126417
Gene: ENSMUSG00000023015
AA Change: A458T

DomainStartEndE-ValueType
coiled coil region 35 110 N/A INTRINSIC
C1 288 336 2.44e-5 SMART
RhoGAP 361 537 3.4e-51 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.2%
  • 10x: 95.4%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein (GAP) that is a compoment of the centralspindlin complex. This protein binds activated forms of Rho GTPases and stimulates GTP hydrolysis, which results in negative regulation of Rho-mediated signals. This protein plays a regulatory role in cytokinesis, cell growth, and differentiation. Alternatively spliced transcript variants have been found for this gene. There is a pseudogene for this gene on chromosome 12. [provided by RefSeq, Feb 2016]
PHENOTYPE: Embryos homozygous for a gene-trapped allele exhibit pre-implantation lethality associated with the formation of multinucleated blastomeres and failure to complete cytokinesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh7a1 A T 18: 56,560,838 probably null Het
Atm A G 9: 53,504,092 V833A probably benign Het
Atp6v1b1 A T 6: 83,753,832 I180F probably damaging Het
Cwf19l2 T C 9: 3,421,286 S188P probably benign Het
Gdpd1 T G 11: 87,037,881 E240D probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Htt T C 5: 34,898,924 S2681P probably damaging Het
Itgad A G 7: 128,175,693 D40G probably benign Het
Krt18 A G 15: 102,030,728 Y249C possibly damaging Het
Lrp2 G T 2: 69,487,838 P2090T probably damaging Het
Lrrc32 A G 7: 98,498,883 D290G probably benign Het
Man1a A T 10: 53,933,523 Y486* probably null Het
Mcm9 CCTGTCCCTGCTGTCCCTGCTGTCCCTGCTGTCCCTGCTGTCC CCTGTCCCTGCTGTCCCTGCTGTCCCTGCTGTCC 10: 53,537,501 probably benign Het
Nin A T 12: 70,061,186 C211S probably damaging Het
Npat A C 9: 53,570,324 I1111L probably benign Het
Olfr1505 T A 19: 13,919,171 H50Q probably benign Het
Olfr507 A G 7: 108,622,672 I287V probably benign Het
Pbx1 A G 1: 168,203,366 S228P probably damaging Het
Pcsk7 G T 9: 45,911,172 R230L probably damaging Het
Prom2 G T 2: 127,538,263 Q350K possibly damaging Het
Rsf1 T A 7: 97,669,778 C912S probably damaging Het
Setd2 G A 9: 110,548,511 E465K possibly damaging Het
Sgk2 T A 2: 163,006,838 D269E probably benign Het
Spsb1 T C 4: 149,907,079 T11A probably benign Het
Tln2 A T 9: 67,295,813 S509T probably benign Het
Trim5 A T 7: 104,265,751 D370E probably damaging Het
Ttn T A 2: 76,885,230 probably benign Het
Ubr2 C A 17: 46,941,112 G1501C probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r93 A T 17: 18,304,081 R112S probably benign Het
Vps26b T C 9: 27,012,781 Y222C probably damaging Het
Wdr64 T A 1: 175,775,749 Y198N probably benign Het
Xrn1 A T 9: 95,998,263 K752I possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp386 T C 12: 116,059,778 I372T probably benign Het
Zfp804a T C 2: 82,258,718 Y964H possibly damaging Het
Other mutations in Racgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Racgap1 APN 15 99636122 unclassified probably benign
IGL01450:Racgap1 APN 15 99626363 missense probably benign 0.00
IGL01907:Racgap1 APN 15 99626333 nonsense probably null
IGL02584:Racgap1 APN 15 99623634 missense probably benign 0.00
IGL02733:Racgap1 APN 15 99639704 missense probably damaging 1.00
IGL03137:Racgap1 APN 15 99628741 missense probably damaging 0.96
IGL03145:Racgap1 APN 15 99623640 missense probably benign 0.00
IGL02799:Racgap1 UTSW 15 99632747 missense probably benign 0.09
R0106:Racgap1 UTSW 15 99642958 missense possibly damaging 0.66
R0106:Racgap1 UTSW 15 99642958 missense possibly damaging 0.66
R0140:Racgap1 UTSW 15 99623651 missense probably benign 0.00
R0398:Racgap1 UTSW 15 99628627 splice site probably benign
R0496:Racgap1 UTSW 15 99639832 splice site probably benign
R0528:Racgap1 UTSW 15 99628706 missense probably damaging 1.00
R0893:Racgap1 UTSW 15 99626530 missense probably benign
R1348:Racgap1 UTSW 15 99626365 missense possibly damaging 0.54
R1470:Racgap1 UTSW 15 99639775 missense probably damaging 0.99
R1470:Racgap1 UTSW 15 99639775 missense probably damaging 0.99
R1720:Racgap1 UTSW 15 99628769 nonsense probably null
R2235:Racgap1 UTSW 15 99626536 missense probably benign
R3624:Racgap1 UTSW 15 99642891 missense probably damaging 0.97
R4621:Racgap1 UTSW 15 99626206 missense probably benign 0.10
R4622:Racgap1 UTSW 15 99626206 missense probably benign 0.10
R4623:Racgap1 UTSW 15 99626206 missense probably benign 0.10
R5046:Racgap1 UTSW 15 99628762 missense probably damaging 1.00
R5899:Racgap1 UTSW 15 99623628 missense possibly damaging 0.80
R6306:Racgap1 UTSW 15 99623953 missense probably benign
R6513:Racgap1 UTSW 15 99624275 missense probably damaging 1.00
R6618:Racgap1 UTSW 15 99623994 missense probably damaging 0.97
R6953:Racgap1 UTSW 15 99626329 missense probably damaging 1.00
R7359:Racgap1 UTSW 15 99631200 missense probably benign
R7463:Racgap1 UTSW 15 99642958 missense probably benign
R8292:Racgap1 UTSW 15 99622246 nonsense probably null
R8883:Racgap1 UTSW 15 99628659 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGATTGGGCACAGTATGGGCAAC -3'
(R):5'- TGCTGTCATGAACCGCATCAGAAG -3'

Sequencing Primer
(F):5'- TTGTAGGGCCAAAGACTTTAGC -3'
(R):5'- AAGTTTCAGAAGCTCCGTGTATAGG -3'
Posted On2013-11-08