Incidental Mutation 'R0948:Hao1'
ID81691
Institutional Source Beutler Lab
Gene Symbol Hao1
Ensembl Gene ENSMUSG00000027261
Gene Namehydroxyacid oxidase 1, liver
SynonymsGOX, Gox1, Hao-1
MMRRC Submission 039087-MU
Accession Numbers

Genbank: NM_010403; MGI: 96011

Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R0948 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location134497361-134554368 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 134530773 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 105 (M105R)
Ref Sequence ENSEMBL: ENSMUSP00000028704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028704]
Predicted Effect probably damaging
Transcript: ENSMUST00000028704
AA Change: M105R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028704
Gene: ENSMUSG00000027261
AA Change: M105R

DomainStartEndE-ValueType
Pfam:FMN_dh 15 362 9.1e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140794
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three related genes that have 2-hydroxyacid oxidase activity yet differ in encoded protein amino acid sequence, tissue expression and substrate preference. Subcellular location of the encoded protein is the peroxisome. Specifically, this gene is expressed primarily in liver and pancreas and the encoded protein is most active on glycolate, a two-carbon substrate. The protein is also active on 2-hydroxy fatty acids. The transcript detected at high levels in pancreas may represent an alternatively spliced form or the use of a multiple near-consensus upstream polyadenylation site. [provided by RefSeq, Jul 2008]
PHENOTYPE: Electrophoretic variants are known for this locus. The a allele determines a fast migrating band in BALB/c, CBA/H, C3H/He and C57BL/6; the b allele, a slow band in NZC; the c allele, the fastest band in DBA/Li, NFS/N, STS, 101/H and 129. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik C T 19: 8,890,026 T63M probably damaging Het
Abcb1a T A 5: 8,740,621 probably null Het
Ahrr T C 13: 74,213,769 D537G probably damaging Het
Anxa4 T A 6: 86,741,931 I269F probably damaging Het
Atm A T 9: 53,495,958 M1160K probably benign Het
Ccdc175 A G 12: 72,131,123 Y434H probably damaging Het
Col19a1 C T 1: 24,296,801 A855T probably damaging Het
Cyp2a4 A G 7: 26,310,788 D246G probably damaging Het
Dmbt1 T C 7: 131,093,117 L840P possibly damaging Het
Dock6 A T 9: 21,801,533 D2009E probably damaging Het
Doxl2 A G 6: 48,976,344 Y401C probably damaging Het
E2f3 C T 13: 29,985,533 A46T probably damaging Het
Ect2l A T 10: 18,140,586 C635S probably damaging Het
Fam129b A G 2: 32,922,860 Y480C probably damaging Het
Fer1l6 A G 15: 58,564,075 D439G probably benign Het
Gm5434 A T 12: 36,090,935 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Igsf10 A G 3: 59,331,104 I552T probably damaging Het
Il31ra A G 13: 112,530,378 S470P possibly damaging Het
Mfsd1 A G 3: 67,596,734 N353S possibly damaging Het
Mga T A 2: 119,941,659 F1667I possibly damaging Het
Nwd2 T C 5: 63,807,312 V1413A probably damaging Het
Olfr906 T G 9: 38,488,948 S306R probably benign Het
Olfr914 G A 9: 38,606,491 V9I possibly damaging Het
Osbpl10 T A 9: 115,167,119 V119E probably damaging Het
Plec C A 15: 76,205,687 R151L probably benign Het
Ptpn12 T C 5: 20,998,043 H579R probably benign Het
Rnase4 G T 14: 51,104,905 G29C probably damaging Het
Sim1 C A 10: 50,981,327 S391* probably null Het
Sobp A T 10: 43,022,209 I460N probably damaging Het
Spns3 A T 11: 72,545,940 D75E probably damaging Het
Strn4 T A 7: 16,837,713 C26* probably null Het
Tacstd2 T A 6: 67,535,118 I197L probably damaging Het
Trpc6 A G 9: 8,610,415 T295A possibly damaging Het
Txnl1 G T 18: 63,692,120 S18R possibly damaging Het
U2surp A G 9: 95,461,497 probably benign Het
Vwce A G 19: 10,653,077 Y500C probably damaging Het
Wdr49 A C 3: 75,450,851 S196A probably benign Het
Wfs1 T C 5: 36,967,561 Y662C probably damaging Het
Wnt8b A C 19: 44,510,529 D133A possibly damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp532 C A 18: 65,623,818 A274E probably damaging Het
Zfp74 A G 7: 29,935,937 probably null Het
Other mutations in Hao1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Hao1 APN 2 134554270 missense probably damaging 0.99
IGL00886:Hao1 APN 2 134523159 missense probably benign 0.00
IGL00954:Hao1 APN 2 134498261 missense possibly damaging 0.87
IGL01472:Hao1 APN 2 134554230 missense probably benign 0.04
IGL01570:Hao1 APN 2 134554200 missense probably damaging 0.97
3-1:Hao1 UTSW 2 134500996 critical splice donor site probably null
R0928:Hao1 UTSW 2 134505616 missense possibly damaging 0.54
R1204:Hao1 UTSW 2 134523027 nonsense probably null
R1748:Hao1 UTSW 2 134498318 missense possibly damaging 0.67
R1827:Hao1 UTSW 2 134530664 missense probably benign 0.09
R1828:Hao1 UTSW 2 134530664 missense probably benign 0.09
R1917:Hao1 UTSW 2 134523060 missense probably benign 0.02
R2054:Hao1 UTSW 2 134498258 synonymous silent
R2070:Hao1 UTSW 2 134530615 missense probably damaging 1.00
R3831:Hao1 UTSW 2 134523005 missense probably damaging 1.00
R3833:Hao1 UTSW 2 134523005 missense probably damaging 1.00
R3960:Hao1 UTSW 2 134522983 critical splice donor site probably null
R4509:Hao1 UTSW 2 134523044 missense probably damaging 0.99
R4635:Hao1 UTSW 2 134523152 missense probably damaging 1.00
R4662:Hao1 UTSW 2 134523027 nonsense probably null
R4716:Hao1 UTSW 2 134505620 missense probably damaging 1.00
R6161:Hao1 UTSW 2 134505625 missense probably benign 0.06
R6374:Hao1 UTSW 2 134523104 missense probably benign 0.14
R6799:Hao1 UTSW 2 134530765 missense probably damaging 1.00
R6876:Hao1 UTSW 2 134501149 missense probably benign 0.00
R7305:Hao1 UTSW 2 134548201 missense probably benign 0.00
R7554:Hao1 UTSW 2 134530618 missense possibly damaging 0.78
R7585:Hao1 UTSW 2 134501156 missense probably damaging 1.00
R7920:Hao1 UTSW 2 134548252 missense probably damaging 1.00
R8528:Hao1 UTSW 2 134522993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAACCTGTTCCGCACGTCAT -3'
(R):5'- ACCCAGAGTGAAATCCAATGCATGTT -3'

Sequencing Primer
(F):5'- GTTCCGCACGTCATCAATG -3'
(R):5'- GAGTGAAATCCAATGCATGTTTTATG -3'
Posted On2013-11-08