Incidental Mutation 'R0948:Osbpl10'
ID81719
Institutional Source Beutler Lab
Gene Symbol Osbpl10
Ensembl Gene ENSMUSG00000040875
Gene Nameoxysterol binding protein-like 10
SynonymsC820004B04Rik, OPR-10, 4933433D06Rik
MMRRC Submission 039087-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0948 (G1)
Quality Score169
Status Not validated
Chromosome9
Chromosomal Location114978569-115232225 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115167119 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 119 (V119E)
Ref Sequence ENSEMBL: ENSMUSP00000138760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046627] [ENSMUST00000182199] [ENSMUST00000182384] [ENSMUST00000183104] [ENSMUST00000183141]
Predicted Effect probably damaging
Transcript: ENSMUST00000046627
AA Change: V83E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038013
Gene: ENSMUSG00000040875
AA Change: V83E

DomainStartEndE-ValueType
low complexity region 95 116 N/A INTRINSIC
Pfam:Oxysterol_BP 229 535 7.8e-70 PFAM
Pfam:Oxysterol_BP 532 589 1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182199
SMART Domains Protein: ENSMUSP00000138206
Gene: ENSMUSG00000040875

DomainStartEndE-ValueType
Blast:PH 1 36 8e-19 BLAST
PDB:2D9X|A 1 42 2e-8 PDB
SCOP:d1ki1b2 10 42 7e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182363
Predicted Effect probably damaging
Transcript: ENSMUST00000182384
AA Change: V119E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138552
Gene: ENSMUSG00000040875
AA Change: V119E

DomainStartEndE-ValueType
Blast:PH 1 36 8e-16 BLAST
PDB:2D9X|A 2 46 6e-7 PDB
SCOP:d1ki1b2 10 42 9e-3 SMART
low complexity region 131 152 N/A INTRINSIC
Pfam:Oxysterol_BP 262 626 1.5e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182413
Predicted Effect probably damaging
Transcript: ENSMUST00000183104
AA Change: V258E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138287
Gene: ENSMUSG00000040875
AA Change: V258E

DomainStartEndE-ValueType
low complexity region 4 75 N/A INTRINSIC
PH 77 175 2.72e-15 SMART
low complexity region 270 291 N/A INTRINSIC
Pfam:Oxysterol_BP 401 765 1.4e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183141
AA Change: V119E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138760
Gene: ENSMUSG00000040875
AA Change: V119E

DomainStartEndE-ValueType
Blast:PH 1 36 3e-18 BLAST
PDB:2D9X|A 2 46 6e-8 PDB
SCOP:d1ki1b2 10 42 9e-4 SMART
low complexity region 131 152 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik C T 19: 8,890,026 T63M probably damaging Het
Abcb1a T A 5: 8,740,621 probably null Het
Ahrr T C 13: 74,213,769 D537G probably damaging Het
Anxa4 T A 6: 86,741,931 I269F probably damaging Het
Atm A T 9: 53,495,958 M1160K probably benign Het
Ccdc175 A G 12: 72,131,123 Y434H probably damaging Het
Col19a1 C T 1: 24,296,801 A855T probably damaging Het
Cyp2a4 A G 7: 26,310,788 D246G probably damaging Het
Dmbt1 T C 7: 131,093,117 L840P possibly damaging Het
Dock6 A T 9: 21,801,533 D2009E probably damaging Het
Doxl2 A G 6: 48,976,344 Y401C probably damaging Het
E2f3 C T 13: 29,985,533 A46T probably damaging Het
Ect2l A T 10: 18,140,586 C635S probably damaging Het
Fam129b A G 2: 32,922,860 Y480C probably damaging Het
Fer1l6 A G 15: 58,564,075 D439G probably benign Het
Gm5434 A T 12: 36,090,935 probably benign Het
Hao1 A C 2: 134,530,773 M105R probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Igsf10 A G 3: 59,331,104 I552T probably damaging Het
Il31ra A G 13: 112,530,378 S470P possibly damaging Het
Mfsd1 A G 3: 67,596,734 N353S possibly damaging Het
Mga T A 2: 119,941,659 F1667I possibly damaging Het
Nwd2 T C 5: 63,807,312 V1413A probably damaging Het
Olfr906 T G 9: 38,488,948 S306R probably benign Het
Olfr914 G A 9: 38,606,491 V9I possibly damaging Het
Plec C A 15: 76,205,687 R151L probably benign Het
Ptpn12 T C 5: 20,998,043 H579R probably benign Het
Rnase4 G T 14: 51,104,905 G29C probably damaging Het
Sim1 C A 10: 50,981,327 S391* probably null Het
Sobp A T 10: 43,022,209 I460N probably damaging Het
Spns3 A T 11: 72,545,940 D75E probably damaging Het
Strn4 T A 7: 16,837,713 C26* probably null Het
Tacstd2 T A 6: 67,535,118 I197L probably damaging Het
Trpc6 A G 9: 8,610,415 T295A possibly damaging Het
Txnl1 G T 18: 63,692,120 S18R possibly damaging Het
U2surp A G 9: 95,461,497 probably benign Het
Vwce A G 19: 10,653,077 Y500C probably damaging Het
Wdr49 A C 3: 75,450,851 S196A probably benign Het
Wfs1 T C 5: 36,967,561 Y662C probably damaging Het
Wnt8b A C 19: 44,510,529 D133A possibly damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp532 C A 18: 65,623,818 A274E probably damaging Het
Zfp74 A G 7: 29,935,937 probably null Het
Other mutations in Osbpl10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Osbpl10 APN 9 115176002 missense probably benign 0.01
IGL01318:Osbpl10 APN 9 115232122 nonsense probably null
IGL02023:Osbpl10 APN 9 115226722 missense probably damaging 1.00
IGL02096:Osbpl10 APN 9 115216994 missense possibly damaging 0.94
R0534:Osbpl10 UTSW 9 115167178 missense probably damaging 1.00
R1073:Osbpl10 UTSW 9 115207553 nonsense probably null
R2138:Osbpl10 UTSW 9 115232134 missense probably benign 0.06
R3709:Osbpl10 UTSW 9 115207587 missense probably benign 0.11
R3710:Osbpl10 UTSW 9 115207587 missense probably benign 0.11
R4406:Osbpl10 UTSW 9 115109481 missense probably damaging 0.96
R4738:Osbpl10 UTSW 9 115216574 missense probably damaging 1.00
R4778:Osbpl10 UTSW 9 115109530 missense probably damaging 1.00
R4779:Osbpl10 UTSW 9 115109530 missense probably damaging 1.00
R5828:Osbpl10 UTSW 9 115061876 missense probably damaging 0.97
R5874:Osbpl10 UTSW 9 115226760 missense probably damaging 1.00
R6052:Osbpl10 UTSW 9 115067315 unclassified probably null
R6103:Osbpl10 UTSW 9 115061872 nonsense probably null
R6174:Osbpl10 UTSW 9 115109487 missense probably benign 0.00
R6246:Osbpl10 UTSW 9 115226774 missense probably benign 0.34
R7008:Osbpl10 UTSW 9 115061848 missense probably damaging 1.00
R7027:Osbpl10 UTSW 9 115223698 missense probably damaging 0.97
R7182:Osbpl10 UTSW 9 115067251 missense probably damaging 1.00
R7285:Osbpl10 UTSW 9 115223703 missense probably damaging 1.00
R7556:Osbpl10 UTSW 9 115207624 missense probably damaging 1.00
R7810:Osbpl10 UTSW 9 115061894 missense probably benign 0.01
R7853:Osbpl10 UTSW 9 115207658 missense probably damaging 1.00
R7905:Osbpl10 UTSW 9 115062010 critical splice donor site probably null
R7936:Osbpl10 UTSW 9 115207658 missense probably damaging 1.00
R7988:Osbpl10 UTSW 9 115062010 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTAACGCCCTCTTCAGGTCAGTG -3'
(R):5'- TGTGATGAGGACAACTGGACCAGC -3'

Sequencing Primer
(F):5'- TTTGGGACATAAATGGATGGACC -3'
(R):5'- GAGTCCAGCACTCACCTG -3'
Posted On2013-11-08