Incidental Mutation 'R0948:Sim1'
ID81722
Institutional Source Beutler Lab
Gene Symbol Sim1
Ensembl Gene ENSMUSG00000019913
Gene Namesingle-minded family bHLH transcription factor 1
SynonymsbHLHe14
MMRRC Submission 039087-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0948 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location50894754-50989152 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 50981327 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 391 (S391*)
Ref Sequence ENSEMBL: ENSMUSP00000020071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020071]
Predicted Effect probably null
Transcript: ENSMUST00000020071
AA Change: S391*
SMART Domains Protein: ENSMUSP00000020071
Gene: ENSMUSG00000019913
AA Change: S391*

DomainStartEndE-ValueType
HLH 6 59 8.73e-6 SMART
PAS 79 145 7.39e-14 SMART
PAS 220 286 5.61e-5 SMART
PAC 292 335 4.63e-6 SMART
Pfam:SIM_C 359 668 2.5e-114 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIM1 and SIM2 genes are Drosophila single-minded (sim) gene homologs. SIM1 transcript was detected only in fetal kidney out of various adult and fetal tissues tested. Since the sim gene plays an important role in Drosophila development and has peak levels of expression during the period of neurogenesis,it was proposed that the human SIM gene is a candidate for involvement in certain dysmorphic features (particularly the facial and skull characteristics), abnormalities of brain development, and/or mental retardation of Down syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene die at birth with abnormalities in the paraventricular and supraoptic nuclei. Heterozygous mutant mice are obese and may also be diabetic, hyperinsulinemic and insulin resistant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik C T 19: 8,890,026 T63M probably damaging Het
Abcb1a T A 5: 8,740,621 probably null Het
Ahrr T C 13: 74,213,769 D537G probably damaging Het
Anxa4 T A 6: 86,741,931 I269F probably damaging Het
Atm A T 9: 53,495,958 M1160K probably benign Het
Ccdc175 A G 12: 72,131,123 Y434H probably damaging Het
Col19a1 C T 1: 24,296,801 A855T probably damaging Het
Cyp2a4 A G 7: 26,310,788 D246G probably damaging Het
Dmbt1 T C 7: 131,093,117 L840P possibly damaging Het
Dock6 A T 9: 21,801,533 D2009E probably damaging Het
Doxl2 A G 6: 48,976,344 Y401C probably damaging Het
E2f3 C T 13: 29,985,533 A46T probably damaging Het
Ect2l A T 10: 18,140,586 C635S probably damaging Het
Fam129b A G 2: 32,922,860 Y480C probably damaging Het
Fer1l6 A G 15: 58,564,075 D439G probably benign Het
Gm5434 A T 12: 36,090,935 probably benign Het
Hao1 A C 2: 134,530,773 M105R probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Igsf10 A G 3: 59,331,104 I552T probably damaging Het
Il31ra A G 13: 112,530,378 S470P possibly damaging Het
Mfsd1 A G 3: 67,596,734 N353S possibly damaging Het
Mga T A 2: 119,941,659 F1667I possibly damaging Het
Nwd2 T C 5: 63,807,312 V1413A probably damaging Het
Olfr906 T G 9: 38,488,948 S306R probably benign Het
Olfr914 G A 9: 38,606,491 V9I possibly damaging Het
Osbpl10 T A 9: 115,167,119 V119E probably damaging Het
Plec C A 15: 76,205,687 R151L probably benign Het
Ptpn12 T C 5: 20,998,043 H579R probably benign Het
Rnase4 G T 14: 51,104,905 G29C probably damaging Het
Sobp A T 10: 43,022,209 I460N probably damaging Het
Spns3 A T 11: 72,545,940 D75E probably damaging Het
Strn4 T A 7: 16,837,713 C26* probably null Het
Tacstd2 T A 6: 67,535,118 I197L probably damaging Het
Trpc6 A G 9: 8,610,415 T295A possibly damaging Het
Txnl1 G T 18: 63,692,120 S18R possibly damaging Het
U2surp A G 9: 95,461,497 probably benign Het
Vwce A G 19: 10,653,077 Y500C probably damaging Het
Wdr49 A C 3: 75,450,851 S196A probably benign Het
Wfs1 T C 5: 36,967,561 Y662C probably damaging Het
Wnt8b A C 19: 44,510,529 D133A possibly damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp532 C A 18: 65,623,818 A274E probably damaging Het
Zfp74 A G 7: 29,935,937 probably null Het
Other mutations in Sim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Sim1 APN 10 50981534 missense probably damaging 0.99
IGL01142:Sim1 APN 10 50910671 missense probably damaging 0.99
IGL01886:Sim1 APN 10 50984315 missense probably damaging 1.00
PIT4585001:Sim1 UTSW 10 50984188 nonsense probably null
R0128:Sim1 UTSW 10 50907961 missense probably damaging 1.00
R0130:Sim1 UTSW 10 50907961 missense probably damaging 1.00
R0717:Sim1 UTSW 10 50909828 missense probably damaging 1.00
R1169:Sim1 UTSW 10 50981522 missense probably benign 0.13
R1388:Sim1 UTSW 10 50895994 missense probably damaging 1.00
R1746:Sim1 UTSW 10 50984109 missense probably benign
R1778:Sim1 UTSW 10 50981553 nonsense probably null
R1834:Sim1 UTSW 10 50909828 missense probably damaging 1.00
R2434:Sim1 UTSW 10 50907958 missense probably damaging 1.00
R2919:Sim1 UTSW 10 50909815 missense probably benign 0.23
R3617:Sim1 UTSW 10 50909528 missense probably damaging 1.00
R3625:Sim1 UTSW 10 50981336 missense probably benign 0.30
R4152:Sim1 UTSW 10 50983854 missense probably damaging 0.98
R4414:Sim1 UTSW 10 50981612 missense probably benign 0.13
R4645:Sim1 UTSW 10 50983997 missense probably benign 0.13
R4781:Sim1 UTSW 10 50983785 missense probably benign 0.08
R4889:Sim1 UTSW 10 50981324 missense probably benign 0.05
R4924:Sim1 UTSW 10 50909902 missense probably damaging 1.00
R6625:Sim1 UTSW 10 50983986 missense probably benign
R6783:Sim1 UTSW 10 50908727 missense possibly damaging 0.72
R6876:Sim1 UTSW 10 50983695 missense possibly damaging 0.77
R6909:Sim1 UTSW 10 50909410 missense possibly damaging 0.92
R6924:Sim1 UTSW 10 50908539 missense probably benign 0.10
R7016:Sim1 UTSW 10 50984250 missense probably benign 0.03
R7135:Sim1 UTSW 10 50895927 missense probably damaging 0.99
R7149:Sim1 UTSW 10 50909540 missense probably damaging 1.00
R7300:Sim1 UTSW 10 50909518 missense probably benign 0.23
R7750:Sim1 UTSW 10 50896035 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCCAAAGGGATTTTCTCTATGGGCA -3'
(R):5'- GAGAACTGCGATCTGGGAACTGC -3'

Sequencing Primer
(F):5'- tcccccataccaccccc -3'
(R):5'- CGATCTGGGAACTGCCTATAC -3'
Posted On2013-11-08