Incidental Mutation 'R0948:Ccdc175'
ID81726
Institutional Source Beutler Lab
Gene Symbol Ccdc175
Ensembl Gene ENSMUSG00000021086
Gene Namecoiled-coil domain containing 175
Synonyms
MMRRC Submission 039087-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R0948 (G1)
Quality Score200
Status Not validated
Chromosome12
Chromosomal Location72101300-72185029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72131123 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 434 (Y434H)
Ref Sequence ENSEMBL: ENSMUSP00000021494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021494]
Predicted Effect probably damaging
Transcript: ENSMUST00000021494
AA Change: Y434H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021494
Gene: ENSMUSG00000021086
AA Change: Y434H

DomainStartEndE-ValueType
coiled coil region 129 164 N/A INTRINSIC
coiled coil region 205 235 N/A INTRINSIC
coiled coil region 295 383 N/A INTRINSIC
low complexity region 470 490 N/A INTRINSIC
coiled coil region 517 537 N/A INTRINSIC
low complexity region 803 819 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179978
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik C T 19: 8,890,026 T63M probably damaging Het
Abcb1a T A 5: 8,740,621 probably null Het
Ahrr T C 13: 74,213,769 D537G probably damaging Het
Anxa4 T A 6: 86,741,931 I269F probably damaging Het
Atm A T 9: 53,495,958 M1160K probably benign Het
Col19a1 C T 1: 24,296,801 A855T probably damaging Het
Cyp2a4 A G 7: 26,310,788 D246G probably damaging Het
Dmbt1 T C 7: 131,093,117 L840P possibly damaging Het
Dock6 A T 9: 21,801,533 D2009E probably damaging Het
Doxl2 A G 6: 48,976,344 Y401C probably damaging Het
E2f3 C T 13: 29,985,533 A46T probably damaging Het
Ect2l A T 10: 18,140,586 C635S probably damaging Het
Fam129b A G 2: 32,922,860 Y480C probably damaging Het
Fer1l6 A G 15: 58,564,075 D439G probably benign Het
Gm5434 A T 12: 36,090,935 probably benign Het
Hao1 A C 2: 134,530,773 M105R probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Igsf10 A G 3: 59,331,104 I552T probably damaging Het
Il31ra A G 13: 112,530,378 S470P possibly damaging Het
Mfsd1 A G 3: 67,596,734 N353S possibly damaging Het
Mga T A 2: 119,941,659 F1667I possibly damaging Het
Nwd2 T C 5: 63,807,312 V1413A probably damaging Het
Olfr906 T G 9: 38,488,948 S306R probably benign Het
Olfr914 G A 9: 38,606,491 V9I possibly damaging Het
Osbpl10 T A 9: 115,167,119 V119E probably damaging Het
Plec C A 15: 76,205,687 R151L probably benign Het
Ptpn12 T C 5: 20,998,043 H579R probably benign Het
Rnase4 G T 14: 51,104,905 G29C probably damaging Het
Sim1 C A 10: 50,981,327 S391* probably null Het
Sobp A T 10: 43,022,209 I460N probably damaging Het
Spns3 A T 11: 72,545,940 D75E probably damaging Het
Strn4 T A 7: 16,837,713 C26* probably null Het
Tacstd2 T A 6: 67,535,118 I197L probably damaging Het
Trpc6 A G 9: 8,610,415 T295A possibly damaging Het
Txnl1 G T 18: 63,692,120 S18R possibly damaging Het
U2surp A G 9: 95,461,497 probably benign Het
Vwce A G 19: 10,653,077 Y500C probably damaging Het
Wdr49 A C 3: 75,450,851 S196A probably benign Het
Wfs1 T C 5: 36,967,561 Y662C probably damaging Het
Wnt8b A C 19: 44,510,529 D133A possibly damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp532 C A 18: 65,623,818 A274E probably damaging Het
Zfp74 A G 7: 29,935,937 probably null Het
Other mutations in Ccdc175
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Ccdc175 APN 12 72131142 splice site probably benign
IGL01805:Ccdc175 APN 12 72129229 splice site probably benign
IGL01807:Ccdc175 APN 12 72159842 missense probably benign 0.02
IGL01985:Ccdc175 APN 12 72128278 nonsense probably null
IGL02719:Ccdc175 APN 12 72175125 missense probably damaging 0.97
IGL02944:Ccdc175 APN 12 72117893 missense probably benign 0.02
IGL03113:Ccdc175 APN 12 72144783 missense probably benign 0.00
IGL03143:Ccdc175 APN 12 72136058 missense probably benign 0.03
IGL03356:Ccdc175 APN 12 72139893 splice site probably null
R0009:Ccdc175 UTSW 12 72135965 missense possibly damaging 0.87
R0233:Ccdc175 UTSW 12 72105876 missense probably benign 0.00
R0233:Ccdc175 UTSW 12 72105876 missense probably benign 0.00
R0609:Ccdc175 UTSW 12 72157507 missense probably benign 0.07
R0706:Ccdc175 UTSW 12 72139948 missense probably benign 0.04
R1054:Ccdc175 UTSW 12 72178544 missense possibly damaging 0.85
R1166:Ccdc175 UTSW 12 72105932 missense probably damaging 1.00
R1481:Ccdc175 UTSW 12 72101948 unclassified probably benign
R1860:Ccdc175 UTSW 12 72105926 missense probably benign
R2077:Ccdc175 UTSW 12 72140020 missense possibly damaging 0.54
R3806:Ccdc175 UTSW 12 72180824 missense possibly damaging 0.72
R3879:Ccdc175 UTSW 12 72136018 missense probably damaging 1.00
R3887:Ccdc175 UTSW 12 72136048 missense possibly damaging 0.65
R4557:Ccdc175 UTSW 12 72128306 missense probably benign 0.08
R4585:Ccdc175 UTSW 12 72175179 missense possibly damaging 0.65
R4686:Ccdc175 UTSW 12 72112278 missense probably damaging 1.00
R4766:Ccdc175 UTSW 12 72112205 missense probably benign 0.00
R4773:Ccdc175 UTSW 12 72136048 missense probably damaging 0.99
R4909:Ccdc175 UTSW 12 72159753 missense probably damaging 1.00
R4964:Ccdc175 UTSW 12 72180845 missense probably damaging 1.00
R5338:Ccdc175 UTSW 12 72184971 missense probably damaging 0.99
R5539:Ccdc175 UTSW 12 72144813 missense probably benign 0.00
R5897:Ccdc175 UTSW 12 72159804 missense probably benign 0.06
R6128:Ccdc175 UTSW 12 72129159 missense probably benign 0.07
R6520:Ccdc175 UTSW 12 72140030 missense probably damaging 0.98
R6523:Ccdc175 UTSW 12 72144791 missense probably benign 0.01
R6917:Ccdc175 UTSW 12 72184905 missense probably damaging 1.00
R7035:Ccdc175 UTSW 12 72155645 missense probably benign 0.01
R7097:Ccdc175 UTSW 12 72128409 splice site probably null
R7339:Ccdc175 UTSW 12 72136041 missense probably damaging 1.00
R7450:Ccdc175 UTSW 12 72155673 missense possibly damaging 0.93
R7481:Ccdc175 UTSW 12 72155624 missense probably benign 0.00
R7676:Ccdc175 UTSW 12 72102047 missense possibly damaging 0.57
Z1088:Ccdc175 UTSW 12 72128379 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCCCTCTCACTCCAGTAGGCTCAG -3'
(R):5'- CAGAATCTGTGTGCTGTTGCTTCCC -3'

Sequencing Primer
(F):5'- caccagaagagggcatcag -3'
(R):5'- GCCGTTCCATCCTTGGATATTAAAC -3'
Posted On2013-11-08