Incidental Mutation 'R0948:E2f3'
ID81727
Institutional Source Beutler Lab
Gene Symbol E2f3
Ensembl Gene ENSMUSG00000016477
Gene NameE2F transcription factor 3
SynonymsE2F3b, E2f3a
MMRRC Submission 039087-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0948 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location29906575-29986063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 29985533 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 46 (A46T)
Ref Sequence ENSEMBL: ENSMUSP00000100012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102948] [ENSMUST00000221536] [ENSMUST00000222730]
Predicted Effect probably damaging
Transcript: ENSMUST00000102948
AA Change: A46T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100012
Gene: ENSMUSG00000016477
AA Change: A46T

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
low complexity region 37 51 N/A INTRINSIC
low complexity region 106 124 N/A INTRINSIC
low complexity region 155 168 N/A INTRINSIC
E2F_TDP 170 235 3.53e-35 SMART
Pfam:E2F_CC-MB 251 344 5.1e-38 PFAM
low complexity region 417 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146092
Predicted Effect probably benign
Transcript: ENSMUST00000221536
Predicted Effect probably benign
Transcript: ENSMUST00000222730
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small family of transcription factors that function through binding of DP interaction partner proteins. The encoded protein recognizes a specific sequence motif in DNA and interacts directly with the retinoblastoma protein (pRB) to regulate the expression of genes involved in the cell cycle. Altered copy number and activity of this gene have been observed in a number of human cancers. There are pseudogenes for this gene on chromosomes 2 and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit increased lethality prior to adulthood but otherwise appear normal. Mouse embryonic fibroblast cells from mice homozygous for a null allele are defective in cell cycle progression and exhibit reduced proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik C T 19: 8,890,026 T63M probably damaging Het
Abcb1a T A 5: 8,740,621 probably null Het
Ahrr T C 13: 74,213,769 D537G probably damaging Het
Anxa4 T A 6: 86,741,931 I269F probably damaging Het
Atm A T 9: 53,495,958 M1160K probably benign Het
Ccdc175 A G 12: 72,131,123 Y434H probably damaging Het
Col19a1 C T 1: 24,296,801 A855T probably damaging Het
Cyp2a4 A G 7: 26,310,788 D246G probably damaging Het
Dmbt1 T C 7: 131,093,117 L840P possibly damaging Het
Dock6 A T 9: 21,801,533 D2009E probably damaging Het
Doxl2 A G 6: 48,976,344 Y401C probably damaging Het
Ect2l A T 10: 18,140,586 C635S probably damaging Het
Fam129b A G 2: 32,922,860 Y480C probably damaging Het
Fer1l6 A G 15: 58,564,075 D439G probably benign Het
Gm5434 A T 12: 36,090,935 probably benign Het
Hao1 A C 2: 134,530,773 M105R probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Igsf10 A G 3: 59,331,104 I552T probably damaging Het
Il31ra A G 13: 112,530,378 S470P possibly damaging Het
Mfsd1 A G 3: 67,596,734 N353S possibly damaging Het
Mga T A 2: 119,941,659 F1667I possibly damaging Het
Nwd2 T C 5: 63,807,312 V1413A probably damaging Het
Olfr906 T G 9: 38,488,948 S306R probably benign Het
Olfr914 G A 9: 38,606,491 V9I possibly damaging Het
Osbpl10 T A 9: 115,167,119 V119E probably damaging Het
Plec C A 15: 76,205,687 R151L probably benign Het
Ptpn12 T C 5: 20,998,043 H579R probably benign Het
Rnase4 G T 14: 51,104,905 G29C probably damaging Het
Sim1 C A 10: 50,981,327 S391* probably null Het
Sobp A T 10: 43,022,209 I460N probably damaging Het
Spns3 A T 11: 72,545,940 D75E probably damaging Het
Strn4 T A 7: 16,837,713 C26* probably null Het
Tacstd2 T A 6: 67,535,118 I197L probably damaging Het
Trpc6 A G 9: 8,610,415 T295A possibly damaging Het
Txnl1 G T 18: 63,692,120 S18R possibly damaging Het
U2surp A G 9: 95,461,497 probably benign Het
Vwce A G 19: 10,653,077 Y500C probably damaging Het
Wdr49 A C 3: 75,450,851 S196A probably benign Het
Wfs1 T C 5: 36,967,561 Y662C probably damaging Het
Wnt8b A C 19: 44,510,529 D133A possibly damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp532 C A 18: 65,623,818 A274E probably damaging Het
Zfp74 A G 7: 29,935,937 probably null Het
Other mutations in E2f3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:E2f3 APN 13 29918704 missense probably damaging 1.00
IGL00774:E2f3 APN 13 29918704 missense probably damaging 1.00
IGL02541:E2f3 APN 13 29916844 critical splice donor site probably null
IGL02669:E2f3 APN 13 29916991 missense probably benign 0.00
IGL03119:E2f3 APN 13 29985365 missense probably benign 0.21
Hillside UTSW 13 29918669 missense probably damaging 1.00
Slippery UTSW 13 29918585 missense possibly damaging 0.94
R0830:E2f3 UTSW 13 29985560 missense probably benign 0.02
R1442:E2f3 UTSW 13 29918669 missense probably damaging 1.00
R1813:E2f3 UTSW 13 29920176 missense probably damaging 0.97
R2496:E2f3 UTSW 13 29911306 missense probably damaging 1.00
R4715:E2f3 UTSW 13 29911275 missense probably damaging 1.00
R5202:E2f3 UTSW 13 29918636 missense probably damaging 1.00
R5902:E2f3 UTSW 13 29985267 unclassified probably benign
R6796:E2f3 UTSW 13 29918585 missense possibly damaging 0.94
R7546:E2f3 UTSW 13 29910129 missense probably damaging 0.98
R7705:E2f3 UTSW 13 29985323 missense probably benign 0.39
R7779:E2f3 UTSW 13 29918615 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAAAGAGGGACTCCCCACTGC -3'
(R):5'- GAGACTTGGAAACTCCGGCTGC -3'

Sequencing Primer
(F):5'- CGCTGAGGAGGGTATTACCG -3'
(R):5'- ACTCCGGCTGCAAATAATAAAAG -3'
Posted On2013-11-08