Incidental Mutation 'R0959:Creb3'
ID81754
Institutional Source Beutler Lab
Gene Symbol Creb3
Ensembl Gene ENSMUSG00000028466
Gene NamecAMP responsive element binding protein 3
SynonymsLZIP, LZIP-1, Luman, LZIP-2
MMRRC Submission 039088-MU
Accession Numbers

NCBI RefSeq: NM_013497.3; MGI: 99946

Is this an essential gene? Probably essential (E-score: 0.841) question?
Stock #R0959 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location43562332-43567060 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43563509 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 163 (L163P)
Ref Sequence ENSEMBL: ENSMUSP00000129401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187] [ENSMUST00000030189] [ENSMUST00000102944] [ENSMUST00000132631] [ENSMUST00000167751]
Predicted Effect probably benign
Transcript: ENSMUST00000030187
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030189
SMART Domains Protein: ENSMUSP00000030189
Gene: ENSMUSG00000028467

DomainStartEndE-ValueType
Pfam:GBA2_N 142 446 9.4e-106 PFAM
Pfam:DUF608 512 879 1.3e-153 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102944
AA Change: L139P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100008
Gene: ENSMUSG00000028466
AA Change: L139P

DomainStartEndE-ValueType
low complexity region 54 83 N/A INTRINSIC
low complexity region 132 147 N/A INTRINSIC
BRLZ 158 222 2.03e-15 SMART
low complexity region 240 253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130670
Predicted Effect probably damaging
Transcript: ENSMUST00000132631
AA Change: L13P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159923
Predicted Effect probably damaging
Transcript: ENSMUST00000167751
AA Change: L163P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129401
Gene: ENSMUSG00000028466
AA Change: L163P

DomainStartEndE-ValueType
low complexity region 54 83 N/A INTRINSIC
low complexity region 156 171 N/A INTRINSIC
BRLZ 182 246 2.03e-15 SMART
low complexity region 264 277 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 95.8%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds to the cAMP-response element and regulates cell proliferation. The protein interacts with host cell factor C1, which also associates with the herpes simplex virus (HSV) protein VP16 that induces transcription of HSV immediate-early genes. This protein and VP16 both bind to the same site on host cell factor C1. It is thought that the interaction between this protein and host cell factor C1 plays a role in the establishment of latency during HSV infection. This protein also plays a role in leukocyte migration, tumor suppression, and endoplasmic reticulum stress-associated protein degradation. Additional transcript variants have been identified, but their biological validity has not been determined.[provided by RefSeq, Nov 2009]
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A G 7: 140,294,791 E394G probably damaging Het
Actl11 T C 9: 107,931,235 V919A probably damaging Het
Adam28 G A 14: 68,607,938 P761L possibly damaging Het
Aplf G A 6: 87,646,083 P338L probably benign Het
Arl5b T A 2: 15,073,131 I89N probably damaging Het
Asap2 T C 12: 21,247,319 V596A probably damaging Het
Baz1b T G 5: 135,244,222 F1400C probably damaging Het
Ccdc149 A T 5: 52,385,155 L365Q probably damaging Het
Ccdc60 A G 5: 116,180,811 S149P probably damaging Het
Ces1b A G 8: 93,068,147 C275R probably damaging Het
Dhx37 T G 5: 125,423,432 N570T probably benign Het
Epc1 T C 18: 6,453,657 N223D probably damaging Het
Gbp5 C T 3: 142,503,124 H143Y possibly damaging Het
Gfod1 A T 13: 43,303,429 D23E probably benign Het
Gm12169 A T 11: 46,536,420 R187* probably null Het
Gm7361 A T 5: 26,262,053 E223D possibly damaging Het
Izumo1 A G 7: 45,624,991 K161E probably damaging Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Lrp1b T C 2: 41,268,354 N1617S possibly damaging Het
Med13l A T 5: 118,754,285 E1924D possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtg2 T G 2: 180,083,428 S145A probably benign Het
Mug2 G A 6: 122,085,495 S1442N probably benign Het
Myo1b A T 1: 51,797,087 I315N probably damaging Het
Naip2 G A 13: 100,154,878 T1184M probably benign Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nsrp1 G A 11: 77,046,459 R304* probably null Het
Olfr444 G T 6: 42,955,752 V85L probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Parp4 T C 14: 56,648,119 F1552L unknown Het
Pigw G A 11: 84,878,207 H99Y probably benign Het
Ppp6r2 G A 15: 89,274,176 M444I possibly damaging Het
Rchy1 A G 5: 91,957,617 F82L probably damaging Het
Reln A C 5: 22,227,628 F125V probably damaging Het
Riok1 G A 13: 38,057,173 E435K probably damaging Het
Rnf213 A G 11: 119,452,581 R3590G probably damaging Het
Scrib G C 15: 76,051,461 P1249A probably benign Het
Shc4 C T 2: 125,678,687 probably null Het
Slc12a2 T A 18: 57,904,378 I520N probably damaging Het
Slc26a5 A G 5: 21,816,961 I484T probably benign Het
Slc39a11 G T 11: 113,464,073 T110K probably benign Het
Snd1 T A 6: 28,884,971 S774T probably benign Het
Spata31d1c C T 13: 65,036,315 P557L probably damaging Het
Svs1 T A 6: 48,988,632 C525S possibly damaging Het
Tada1 A G 1: 166,388,629 D133G probably benign Het
Tg A T 15: 66,708,010 T1555S probably damaging Het
Thra A G 11: 98,753,629 E15G possibly damaging Het
Ttn T A 2: 76,795,096 I15128F probably damaging Het
Ube2r2 A G 4: 41,174,066 Y68C probably damaging Het
Uncx A T 5: 139,546,687 N169I probably damaging Het
Vmn2r100 A G 17: 19,523,524 Y483C possibly damaging Het
Xkr4 T C 1: 3,216,674 D431G probably damaging Het
Xylb C A 9: 119,380,025 A311E possibly damaging Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Zbtb39 C A 10: 127,743,062 H502N probably damaging Het
Zfp82 A G 7: 30,056,451 L402P probably damaging Het
Zpbp2 G A 11: 98,557,625 R256Q probably benign Het
Other mutations in Creb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Creb3 APN 4 43565517 missense probably benign
IGL02641:Creb3 APN 4 43563311 missense probably benign 0.00
IGL03101:Creb3 APN 4 43563081 missense probably benign 0.11
IGL03163:Creb3 APN 4 43566315 missense probably damaging 1.00
P0014:Creb3 UTSW 4 43563265 missense possibly damaging 0.53
PIT4362001:Creb3 UTSW 4 43565472 nonsense probably null
R1506:Creb3 UTSW 4 43566193 missense possibly damaging 0.95
R1624:Creb3 UTSW 4 43566375 missense possibly damaging 0.67
R1693:Creb3 UTSW 4 43566755 missense probably damaging 1.00
R1794:Creb3 UTSW 4 43563302 missense probably benign 0.06
R1956:Creb3 UTSW 4 43563279 critical splice acceptor site probably null
R1991:Creb3 UTSW 4 43565327 missense probably damaging 1.00
R2179:Creb3 UTSW 4 43566306 missense probably damaging 1.00
R3811:Creb3 UTSW 4 43565501 nonsense probably null
R4673:Creb3 UTSW 4 43563192 missense probably benign 0.20
R4713:Creb3 UTSW 4 43563247 missense probably benign 0.00
R5613:Creb3 UTSW 4 43566196 missense probably benign 0.41
R6195:Creb3 UTSW 4 43566346 missense probably benign 0.23
R7673:Creb3 UTSW 4 43563117 missense not run
R7829:Creb3 UTSW 4 43566322 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCCGTGCAAGAACTGAGCGAC -3'
(R):5'- AGGCCCTTCACTTTCAAGGCTCTG -3'

Sequencing Primer
(F):5'- TGCAGATACTGAGAGCTTCG -3'
(R):5'- CTTTCAAGGCTCTGTACTAAAGTTAC -3'
Posted On2013-11-08