Incidental Mutation 'R0959:Kcnh2'
ID81757
Institutional Source Beutler Lab
Gene Symbol Kcnh2
Ensembl Gene ENSMUSG00000038319
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 2
Synonymsmerg1a, M-erg, Lqt2, ERG1, ether a go-go related, merg1b, LQT
MMRRC Submission 039088-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.680) question?
Stock #R0959 (G1)
Quality Score170
Status Not validated
Chromosome5
Chromosomal Location24319589-24351604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24322672 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 894 (R894H)
Ref Sequence ENSEMBL: ENSMUSP00000047705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036092] [ENSMUST00000115098]
Predicted Effect probably damaging
Transcript: ENSMUST00000036092
AA Change: R894H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047705
Gene: ENSMUSG00000038319
AA Change: R894H

DomainStartEndE-ValueType
PAS 13 87 9.54e0 SMART
PAC 93 135 1.31e-5 SMART
low complexity region 194 199 N/A INTRINSIC
Pfam:Ion_trans 409 673 7.8e-38 PFAM
Pfam:Ion_trans_2 600 667 3.2e-13 PFAM
cNMP 744 862 1.15e-24 SMART
low complexity region 885 896 N/A INTRINSIC
low complexity region 925 956 N/A INTRINSIC
low complexity region 965 982 N/A INTRINSIC
coiled coil region 1035 1069 N/A INTRINSIC
low complexity region 1082 1108 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115098
AA Change: R552H

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110750
Gene: ENSMUSG00000038319
AA Change: R552H

DomainStartEndE-ValueType
Pfam:Ion_trans 114 319 1.4e-22 PFAM
Pfam:Ion_trans_2 257 325 2.9e-14 PFAM
cNMP 402 520 1.15e-24 SMART
low complexity region 543 554 N/A INTRINSIC
low complexity region 583 614 N/A INTRINSIC
low complexity region 623 640 N/A INTRINSIC
coiled coil region 693 727 N/A INTRINSIC
low complexity region 740 766 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142197
Meta Mutation Damage Score 0.2624 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 95.8%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-activated potassium channel belonging to the eag family. It shares sequence similarity with the Drosophila ether-a-go-go (eag) gene. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice which maintain expression of the A isoform and lack expression of the B isoform are predisposed to episodic sinus bradycardia. Mice with mutations causing defects in both isoforms are embryonic lethal with defects in cardiac development and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A G 7: 140,294,791 E394G probably damaging Het
Actl11 T C 9: 107,931,235 V919A probably damaging Het
Adam28 G A 14: 68,607,938 P761L possibly damaging Het
Aplf G A 6: 87,646,083 P338L probably benign Het
Arl5b T A 2: 15,073,131 I89N probably damaging Het
Asap2 T C 12: 21,247,319 V596A probably damaging Het
Baz1b T G 5: 135,244,222 F1400C probably damaging Het
Ccdc149 A T 5: 52,385,155 L365Q probably damaging Het
Ccdc60 A G 5: 116,180,811 S149P probably damaging Het
Ces1b A G 8: 93,068,147 C275R probably damaging Het
Creb3 T C 4: 43,563,509 L163P probably damaging Het
Dhx37 T G 5: 125,423,432 N570T probably benign Het
Epc1 T C 18: 6,453,657 N223D probably damaging Het
Gbp5 C T 3: 142,503,124 H143Y possibly damaging Het
Gfod1 A T 13: 43,303,429 D23E probably benign Het
Gm12169 A T 11: 46,536,420 R187* probably null Het
Gm7361 A T 5: 26,262,053 E223D possibly damaging Het
Izumo1 A G 7: 45,624,991 K161E probably damaging Het
Lrp1b T C 2: 41,268,354 N1617S possibly damaging Het
Med13l A T 5: 118,754,285 E1924D possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtg2 T G 2: 180,083,428 S145A probably benign Het
Mug2 G A 6: 122,085,495 S1442N probably benign Het
Myo1b A T 1: 51,797,087 I315N probably damaging Het
Naip2 G A 13: 100,154,878 T1184M probably benign Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nsrp1 G A 11: 77,046,459 R304* probably null Het
Olfr444 G T 6: 42,955,752 V85L probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Parp4 T C 14: 56,648,119 F1552L unknown Het
Pigw G A 11: 84,878,207 H99Y probably benign Het
Ppp6r2 G A 15: 89,274,176 M444I possibly damaging Het
Rchy1 A G 5: 91,957,617 F82L probably damaging Het
Reln A C 5: 22,227,628 F125V probably damaging Het
Riok1 G A 13: 38,057,173 E435K probably damaging Het
Rnf213 A G 11: 119,452,581 R3590G probably damaging Het
Scrib G C 15: 76,051,461 P1249A probably benign Het
Shc4 C T 2: 125,678,687 probably null Het
Slc12a2 T A 18: 57,904,378 I520N probably damaging Het
Slc26a5 A G 5: 21,816,961 I484T probably benign Het
Slc39a11 G T 11: 113,464,073 T110K probably benign Het
Snd1 T A 6: 28,884,971 S774T probably benign Het
Spata31d1c C T 13: 65,036,315 P557L probably damaging Het
Svs1 T A 6: 48,988,632 C525S possibly damaging Het
Tada1 A G 1: 166,388,629 D133G probably benign Het
Tg A T 15: 66,708,010 T1555S probably damaging Het
Thra A G 11: 98,753,629 E15G possibly damaging Het
Ttn T A 2: 76,795,096 I15128F probably damaging Het
Ube2r2 A G 4: 41,174,066 Y68C probably damaging Het
Uncx A T 5: 139,546,687 N169I probably damaging Het
Vmn2r100 A G 17: 19,523,524 Y483C possibly damaging Het
Xkr4 T C 1: 3,216,674 D431G probably damaging Het
Xylb C A 9: 119,380,025 A311E possibly damaging Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Zbtb39 C A 10: 127,743,062 H502N probably damaging Het
Zfp82 A G 7: 30,056,451 L402P probably damaging Het
Zpbp2 G A 11: 98,557,625 R256Q probably benign Het
Other mutations in Kcnh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Kcnh2 APN 5 24324966 missense probably damaging 1.00
IGL01536:Kcnh2 APN 5 24326524 missense probably damaging 1.00
IGL02305:Kcnh2 APN 5 24322660 missense possibly damaging 0.86
IGL02379:Kcnh2 APN 5 24326638 missense probably damaging 1.00
IGL03100:Kcnh2 APN 5 24322684 missense probably damaging 1.00
IGL03326:Kcnh2 APN 5 24326413 missense probably damaging 1.00
R0077:Kcnh2 UTSW 5 24322702 missense probably benign 0.11
R0349:Kcnh2 UTSW 5 24351237 missense probably benign 0.18
R0960:Kcnh2 UTSW 5 24322672 missense probably damaging 1.00
R0963:Kcnh2 UTSW 5 24322672 missense probably damaging 1.00
R1130:Kcnh2 UTSW 5 24331825 nonsense probably null
R1147:Kcnh2 UTSW 5 24324387 missense probably damaging 1.00
R1147:Kcnh2 UTSW 5 24324387 missense probably damaging 1.00
R1201:Kcnh2 UTSW 5 24322672 missense probably damaging 1.00
R1346:Kcnh2 UTSW 5 24322660 missense possibly damaging 0.86
R1608:Kcnh2 UTSW 5 24322219 missense probably benign
R1613:Kcnh2 UTSW 5 24322762 splice site probably benign
R1797:Kcnh2 UTSW 5 24322672 missense probably damaging 1.00
R2006:Kcnh2 UTSW 5 24326570 missense probably damaging 1.00
R2312:Kcnh2 UTSW 5 24324954 critical splice donor site probably null
R2435:Kcnh2 UTSW 5 24326347 critical splice donor site probably null
R4623:Kcnh2 UTSW 5 24348442 missense probably benign 0.00
R4941:Kcnh2 UTSW 5 24331087 missense probably damaging 0.98
R5394:Kcnh2 UTSW 5 24332041 missense probably benign
R5467:Kcnh2 UTSW 5 24326767 nonsense probably null
R6127:Kcnh2 UTSW 5 24325003 missense probably damaging 1.00
R6135:Kcnh2 UTSW 5 24321793 missense probably damaging 1.00
R6280:Kcnh2 UTSW 5 24331923 missense probably benign 0.43
R6936:Kcnh2 UTSW 5 24324339 missense probably damaging 1.00
R7061:Kcnh2 UTSW 5 24331922 missense probably benign 0.01
R7136:Kcnh2 UTSW 5 24332991 missense probably benign 0.13
R7399:Kcnh2 UTSW 5 24322059 missense probably damaging 0.99
R7479:Kcnh2 UTSW 5 24325492 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAAGCCCAGCCTTTGTCCAGTG -3'
(R):5'- GACTGTGGAAAACAGCTTCTTTGCC -3'

Sequencing Primer
(F):5'- CCTTTGTCCAGTGGAAGGGAG -3'
(R):5'- GGGTAGGGAAAATTCTTCCCCAC -3'
Posted On2013-11-08