Incidental Mutation 'R0959:Ccdc60'
ID81761
Institutional Source Beutler Lab
Gene Symbol Ccdc60
Ensembl Gene ENSMUSG00000043913
Gene Namecoiled-coil domain containing 60
Synonyms
MMRRC Submission 039088-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0959 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location116124641-116288985 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116180811 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 149 (S149P)
Ref Sequence ENSEMBL: ENSMUSP00000083671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050178] [ENSMUST00000086483]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050178
AA Change: S149P

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049912
Gene: ENSMUSG00000043913
AA Change: S149P

DomainStartEndE-ValueType
Pfam:DUF4698 60 535 6.3e-225 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086483
AA Change: S149P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083671
Gene: ENSMUSG00000043913
AA Change: S149P

DomainStartEndE-ValueType
low complexity region 81 95 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 95.8%
  • 20x: 89.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A G 7: 140,294,791 E394G probably damaging Het
Actl11 T C 9: 107,931,235 V919A probably damaging Het
Adam28 G A 14: 68,607,938 P761L possibly damaging Het
Aplf G A 6: 87,646,083 P338L probably benign Het
Arl5b T A 2: 15,073,131 I89N probably damaging Het
Asap2 T C 12: 21,247,319 V596A probably damaging Het
Baz1b T G 5: 135,244,222 F1400C probably damaging Het
Ccdc149 A T 5: 52,385,155 L365Q probably damaging Het
Ces1b A G 8: 93,068,147 C275R probably damaging Het
Creb3 T C 4: 43,563,509 L163P probably damaging Het
Dhx37 T G 5: 125,423,432 N570T probably benign Het
Epc1 T C 18: 6,453,657 N223D probably damaging Het
Gbp5 C T 3: 142,503,124 H143Y possibly damaging Het
Gfod1 A T 13: 43,303,429 D23E probably benign Het
Gm12169 A T 11: 46,536,420 R187* probably null Het
Gm7361 A T 5: 26,262,053 E223D possibly damaging Het
Izumo1 A G 7: 45,624,991 K161E probably damaging Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Lrp1b T C 2: 41,268,354 N1617S possibly damaging Het
Med13l A T 5: 118,754,285 E1924D possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtg2 T G 2: 180,083,428 S145A probably benign Het
Mug2 G A 6: 122,085,495 S1442N probably benign Het
Myo1b A T 1: 51,797,087 I315N probably damaging Het
Naip2 G A 13: 100,154,878 T1184M probably benign Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nsrp1 G A 11: 77,046,459 R304* probably null Het
Olfr444 G T 6: 42,955,752 V85L probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Parp4 T C 14: 56,648,119 F1552L unknown Het
Pigw G A 11: 84,878,207 H99Y probably benign Het
Ppp6r2 G A 15: 89,274,176 M444I possibly damaging Het
Rchy1 A G 5: 91,957,617 F82L probably damaging Het
Reln A C 5: 22,227,628 F125V probably damaging Het
Riok1 G A 13: 38,057,173 E435K probably damaging Het
Rnf213 A G 11: 119,452,581 R3590G probably damaging Het
Scrib G C 15: 76,051,461 P1249A probably benign Het
Shc4 C T 2: 125,678,687 probably null Het
Slc12a2 T A 18: 57,904,378 I520N probably damaging Het
Slc26a5 A G 5: 21,816,961 I484T probably benign Het
Slc39a11 G T 11: 113,464,073 T110K probably benign Het
Snd1 T A 6: 28,884,971 S774T probably benign Het
Spata31d1c C T 13: 65,036,315 P557L probably damaging Het
Svs1 T A 6: 48,988,632 C525S possibly damaging Het
Tada1 A G 1: 166,388,629 D133G probably benign Het
Tg A T 15: 66,708,010 T1555S probably damaging Het
Thra A G 11: 98,753,629 E15G possibly damaging Het
Ttn T A 2: 76,795,096 I15128F probably damaging Het
Ube2r2 A G 4: 41,174,066 Y68C probably damaging Het
Uncx A T 5: 139,546,687 N169I probably damaging Het
Vmn2r100 A G 17: 19,523,524 Y483C possibly damaging Het
Xkr4 T C 1: 3,216,674 D431G probably damaging Het
Xylb C A 9: 119,380,025 A311E possibly damaging Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Zbtb39 C A 10: 127,743,062 H502N probably damaging Het
Zfp82 A G 7: 30,056,451 L402P probably damaging Het
Zpbp2 G A 11: 98,557,625 R256Q probably benign Het
Other mutations in Ccdc60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02838:Ccdc60 APN 5 116134110 missense probably damaging 1.00
IGL03095:Ccdc60 APN 5 116146215 splice site probably benign
IGL03235:Ccdc60 APN 5 116131146 missense probably benign
R0630:Ccdc60 UTSW 5 116136381 missense possibly damaging 0.75
R0740:Ccdc60 UTSW 5 116190076 missense probably damaging 1.00
R1061:Ccdc60 UTSW 5 116172468 missense possibly damaging 0.78
R1760:Ccdc60 UTSW 5 116172473 missense probably damaging 0.99
R1940:Ccdc60 UTSW 5 116126165 missense probably damaging 1.00
R1960:Ccdc60 UTSW 5 116146184 missense probably benign 0.36
R2190:Ccdc60 UTSW 5 116157580 missense probably damaging 1.00
R3856:Ccdc60 UTSW 5 116172455 missense probably damaging 1.00
R4866:Ccdc60 UTSW 5 116172490 missense probably damaging 1.00
R5015:Ccdc60 UTSW 5 116288448 missense probably benign 0.00
R6169:Ccdc60 UTSW 5 116137072 missense probably benign 0.16
R6379:Ccdc60 UTSW 5 116131023 critical splice donor site probably null
R7081:Ccdc60 UTSW 5 116126087 missense probably benign 0.20
Z1177:Ccdc60 UTSW 5 116288709 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGCATATTTGCTGCTGGGGTCTAAC -3'
(R):5'- GCATCCGGTGTCTCTGAAACAAGG -3'

Sequencing Primer
(F):5'- GCTGGGGTCTAACTTACCAC -3'
(R):5'- CGGTGTCTCTGAAACAAGGAATTTAC -3'
Posted On2013-11-08