Incidental Mutation 'R0959:Uncx'
ID81765
Institutional Source Beutler Lab
Gene Symbol Uncx
Ensembl Gene ENSMUSG00000029546
Gene NameUNC homeobox
SynonymsChx4, Uncx4.1
MMRRC Submission 039088-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0959 (G1)
Quality Score191
Status Not validated
Chromosome5
Chromosomal Location139543494-139548179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 139546687 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 169 (N169I)
Ref Sequence ENSEMBL: ENSMUSP00000134067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172997] [ENSMUST00000174792]
Predicted Effect probably damaging
Transcript: ENSMUST00000031523
AA Change: N169I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031523
Gene: ENSMUSG00000029546
AA Change: N169I

DomainStartEndE-ValueType
HOX 109 171 1.49e-25 SMART
coiled coil region 194 222 N/A INTRINSIC
low complexity region 230 267 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
low complexity region 347 356 N/A INTRINSIC
low complexity region 408 420 N/A INTRINSIC
low complexity region 424 439 N/A INTRINSIC
low complexity region 442 456 N/A INTRINSIC
low complexity region 462 474 N/A INTRINSIC
low complexity region 480 506 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172997
AA Change: N169I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134067
Gene: ENSMUSG00000029546
AA Change: N169I

DomainStartEndE-ValueType
low complexity region 8 13 N/A INTRINSIC
low complexity region 30 47 N/A INTRINSIC
low complexity region 110 138 N/A INTRINSIC
low complexity region 162 178 N/A INTRINSIC
low complexity region 184 207 N/A INTRINSIC
low complexity region 215 233 N/A INTRINSIC
low complexity region 239 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174792
SMART Domains Protein: ENSMUSP00000139081
Gene: ENSMUSG00000029546

DomainStartEndE-ValueType
HOX 109 164 1.9e-10 SMART
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 95.8%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants exhibit severe skeletal defects, including absence of pedicles, transverse processes and proximal ribs. Mutants die around birth from respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A G 7: 140,294,791 E394G probably damaging Het
Actl11 T C 9: 107,931,235 V919A probably damaging Het
Adam28 G A 14: 68,607,938 P761L possibly damaging Het
Aplf G A 6: 87,646,083 P338L probably benign Het
Arl5b T A 2: 15,073,131 I89N probably damaging Het
Asap2 T C 12: 21,247,319 V596A probably damaging Het
Baz1b T G 5: 135,244,222 F1400C probably damaging Het
Ccdc149 A T 5: 52,385,155 L365Q probably damaging Het
Ccdc60 A G 5: 116,180,811 S149P probably damaging Het
Ces1b A G 8: 93,068,147 C275R probably damaging Het
Creb3 T C 4: 43,563,509 L163P probably damaging Het
Dhx37 T G 5: 125,423,432 N570T probably benign Het
Epc1 T C 18: 6,453,657 N223D probably damaging Het
Gbp5 C T 3: 142,503,124 H143Y possibly damaging Het
Gfod1 A T 13: 43,303,429 D23E probably benign Het
Gm12169 A T 11: 46,536,420 R187* probably null Het
Gm7361 A T 5: 26,262,053 E223D possibly damaging Het
Izumo1 A G 7: 45,624,991 K161E probably damaging Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Lrp1b T C 2: 41,268,354 N1617S possibly damaging Het
Med13l A T 5: 118,754,285 E1924D possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtg2 T G 2: 180,083,428 S145A probably benign Het
Mug2 G A 6: 122,085,495 S1442N probably benign Het
Myo1b A T 1: 51,797,087 I315N probably damaging Het
Naip2 G A 13: 100,154,878 T1184M probably benign Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nsrp1 G A 11: 77,046,459 R304* probably null Het
Olfr444 G T 6: 42,955,752 V85L probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Parp4 T C 14: 56,648,119 F1552L unknown Het
Pigw G A 11: 84,878,207 H99Y probably benign Het
Ppp6r2 G A 15: 89,274,176 M444I possibly damaging Het
Rchy1 A G 5: 91,957,617 F82L probably damaging Het
Reln A C 5: 22,227,628 F125V probably damaging Het
Riok1 G A 13: 38,057,173 E435K probably damaging Het
Rnf213 A G 11: 119,452,581 R3590G probably damaging Het
Scrib G C 15: 76,051,461 P1249A probably benign Het
Shc4 C T 2: 125,678,687 probably null Het
Slc12a2 T A 18: 57,904,378 I520N probably damaging Het
Slc26a5 A G 5: 21,816,961 I484T probably benign Het
Slc39a11 G T 11: 113,464,073 T110K probably benign Het
Snd1 T A 6: 28,884,971 S774T probably benign Het
Spata31d1c C T 13: 65,036,315 P557L probably damaging Het
Svs1 T A 6: 48,988,632 C525S possibly damaging Het
Tada1 A G 1: 166,388,629 D133G probably benign Het
Tg A T 15: 66,708,010 T1555S probably damaging Het
Thra A G 11: 98,753,629 E15G possibly damaging Het
Ttn T A 2: 76,795,096 I15128F probably damaging Het
Ube2r2 A G 4: 41,174,066 Y68C probably damaging Het
Vmn2r100 A G 17: 19,523,524 Y483C possibly damaging Het
Xkr4 T C 1: 3,216,674 D431G probably damaging Het
Xylb C A 9: 119,380,025 A311E possibly damaging Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Zbtb39 C A 10: 127,743,062 H502N probably damaging Het
Zfp82 A G 7: 30,056,451 L402P probably damaging Het
Zpbp2 G A 11: 98,557,625 R256Q probably benign Het
Other mutations in Uncx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02616:Uncx APN 5 139546768 missense possibly damaging 0.95
PIT4378001:Uncx UTSW 5 139544622 nonsense probably null
R0658:Uncx UTSW 5 139544187 missense probably damaging 0.99
R1786:Uncx UTSW 5 139547547 missense probably benign 0.00
R3870:Uncx UTSW 5 139547365 missense probably damaging 0.98
R4022:Uncx UTSW 5 139546689 missense probably damaging 0.97
R4512:Uncx UTSW 5 139546767 missense possibly damaging 0.59
R4514:Uncx UTSW 5 139546767 missense possibly damaging 0.59
R4604:Uncx UTSW 5 139544082 missense possibly damaging 0.95
R4864:Uncx UTSW 5 139544120 missense probably damaging 0.98
R5048:Uncx UTSW 5 139547119 missense probably benign 0.00
R5408:Uncx UTSW 5 139544490 nonsense probably null
R5954:Uncx UTSW 5 139547629 missense probably benign
R5997:Uncx UTSW 5 139547589 missense probably damaging 1.00
R7477:Uncx UTSW 5 139547262 missense probably benign
R7563:Uncx UTSW 5 139544506 missense probably damaging 1.00
R7598:Uncx UTSW 5 139544054 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGGTCCATCCAAGTTCGGCTTCAC -3'
(R):5'- CGGCTCTGACTCTTGAGCAGTTTC -3'

Sequencing Primer
(F):5'- GGCCCCTTAGAACTGAGAGAC -3'
(R):5'- CTTGAGCAGTTTCTTCTCGTG -3'
Posted On2013-11-08