Mutagenetix > Incidental Mutations

Incidental Mutation 'R0959:Riok1'

81790

Institutional Source

Beutler Lab

Gene Symbol

Riok1

Ensembl Gene

ENSMUSG00000021428

Gene Name

RIO kinase 1

Synonyms

MMRRC Submission

039088-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R0959 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

38036995-38061433 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 38057173 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 435 (E435K)

Ref Sequence

ENSEMBL: ENSMUSP00000021866 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021866] [ENSMUST00000223656]

Predicted Effect

probably damaging
Transcript: ENSMUST00000021866
AA Change: E435K

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000021866
Gene: ENSMUSG00000021428
AA Change: E435K

Domain	Start	End	E-Value	Type
low complexity region	54	75	N/A	INTRINSIC
RIO	150	386	5.1e-134	SMART
Blast:RIO	465	531	4e-12	BLAST
low complexity region	551	567	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000223656

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224962

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225174

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226056

Coding Region Coverage

1x: 99.6%
3x: 98.7%
10x: 95.8%
20x: 89.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the RIO family of atypical serine protein kinases. A similar protein in humans is a component of the protein arginine methyltransferase 5 complex that specifically recruits the RNA-binding protein nucleolin as a methylation substrate. [provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830411N06Rik	A	G	7: 140,294,791	E394G	probably damaging	Het
Actl11	T	C	9: 107,931,235	V919A	probably damaging	Het
Adam28	G	A	14: 68,607,938	P761L	possibly damaging	Het
Aplf	G	A	6: 87,646,083	P338L	probably benign	Het
Arl5b	T	A	2: 15,073,131	I89N	probably damaging	Het
Asap2	T	C	12: 21,247,319	V596A	probably damaging	Het
Baz1b	T	G	5: 135,244,222	F1400C	probably damaging	Het
Ccdc149	A	T	5: 52,385,155	L365Q	probably damaging	Het
Ccdc60	A	G	5: 116,180,811	S149P	probably damaging	Het
Ces1b	A	G	8: 93,068,147	C275R	probably damaging	Het
Creb3	T	C	4: 43,563,509	L163P	probably damaging	Het
Dhx37	T	G	5: 125,423,432	N570T	probably benign	Het
Epc1	T	C	18: 6,453,657	N223D	probably damaging	Het
Gbp5	C	T	3: 142,503,124	H143Y	possibly damaging	Het
Gfod1	A	T	13: 43,303,429	D23E	probably benign	Het
Gm12169	A	T	11: 46,536,420	R187*	probably null	Het
Gm7361	A	T	5: 26,262,053	E223D	possibly damaging	Het
Izumo1	A	G	7: 45,624,991	K161E	probably damaging	Het
Kcnh2	C	T	5: 24,322,672	R894H	probably damaging	Het
Lrp1b	T	C	2: 41,268,354	N1617S	possibly damaging	Het
Med13l	A	T	5: 118,754,285	E1924D	possibly damaging	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mtg2	T	G	2: 180,083,428	S145A	probably benign	Het
Mug2	G	A	6: 122,085,495	S1442N	probably benign	Het
Myo1b	A	T	1: 51,797,087	I315N	probably damaging	Het
Naip2	G	A	13: 100,154,878	T1184M	probably benign	Het
Naip2	T	A	13: 100,154,911	H1173L	probably benign	Het
Nsrp1	G	A	11: 77,046,459	R304*	probably null	Het
Olfr444	G	T	6: 42,955,752	V85L	probably benign	Het
Oxtr	C	T	6: 112,477,177	R42Q	probably benign	Het
Parp4	T	C	14: 56,648,119	F1552L	unknown	Het
Pigw	G	A	11: 84,878,207	H99Y	probably benign	Het
Ppp6r2	G	A	15: 89,274,176	M444I	possibly damaging	Het
Rchy1	A	G	5: 91,957,617	F82L	probably damaging	Het
Reln	A	C	5: 22,227,628	F125V	probably damaging	Het
Rnf213	A	G	11: 119,452,581	R3590G	probably damaging	Het
Scrib	G	C	15: 76,051,461	P1249A	probably benign	Het
Shc4	C	T	2: 125,678,687		probably null	Het
Slc12a2	T	A	18: 57,904,378	I520N	probably damaging	Het
Slc26a5	A	G	5: 21,816,961	I484T	probably benign	Het
Slc39a11	G	T	11: 113,464,073	T110K	probably benign	Het
Snd1	T	A	6: 28,884,971	S774T	probably benign	Het
Spata31d1c	C	T	13: 65,036,315	P557L	probably damaging	Het
Svs1	T	A	6: 48,988,632	C525S	possibly damaging	Het
Tada1	A	G	1: 166,388,629	D133G	probably benign	Het
Tg	A	T	15: 66,708,010	T1555S	probably damaging	Het
Thra	A	G	11: 98,753,629	E15G	possibly damaging	Het
Ttn	T	A	2: 76,795,096	I15128F	probably damaging	Het
Ube2r2	A	G	4: 41,174,066	Y68C	probably damaging	Het
Uncx	A	T	5: 139,546,687	N169I	probably damaging	Het
Vmn2r100	A	G	17: 19,523,524	Y483C	possibly damaging	Het
Xkr4	T	C	1: 3,216,674	D431G	probably damaging	Het
Xylb	C	A	9: 119,380,025	A311E	possibly damaging	Het
Zbtb39	C	G	10: 127,742,306	Q250E	probably benign	Het
Zbtb39	C	A	10: 127,743,062	H502N	probably damaging	Het
Zfp82	A	G	7: 30,056,451	L402P	probably damaging	Het
Zpbp2	G	A	11: 98,557,625	R256Q	probably benign	Het

Other mutations in Riok1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02116:Riok1	APN	13	38059956	missense	possibly damaging	0.80
IGL02675:Riok1	APN	13	38050243	missense	probably damaging	0.99
IGL02892:Riok1	APN	13	38040065	splice site	probably benign
IGL02952:Riok1	APN	13	38048890	missense	probably damaging	1.00
IGL03386:Riok1	APN	13	38057237	nonsense	probably null
IGL03054:Riok1	UTSW	13	38047315	missense	probably damaging	1.00
R1423:Riok1	UTSW	13	38049114	missense	probably damaging	1.00
R1558:Riok1	UTSW	13	38050855	missense	probably damaging	1.00
R1624:Riok1	UTSW	13	38037511	missense	probably damaging	1.00
R1717:Riok1	UTSW	13	38052950	missense	probably damaging	1.00
R1858:Riok1	UTSW	13	38058718	nonsense	probably null
R1920:Riok1	UTSW	13	38057201	missense	probably benign	0.27
R2857:Riok1	UTSW	13	38049077	missense	probably damaging	1.00
R4179:Riok1	UTSW	13	38048955	missense	probably damaging	1.00
R7052:Riok1	UTSW	13	38037015	unclassified	probably benign
R7354:Riok1	UTSW	13	38047312	missense	probably benign	0.15
R7689:Riok1	UTSW	13	38045287	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTTCCTCAGATGCCCTTTGGAATG -3'
(R):5'- TGGAAATGCACCGCCCTCTCTTAC -3'

Sequencing Primer
(F):5'- cactctctttctcccctaagtc -3'
(R):5'- CTTATGCAGCACGTATGGAAGC -3'

Posted On

2013-11-08