Incidental Mutation 'R0959:Adam28'
ID81796
Institutional Source Beutler Lab
Gene Symbol Adam28
Ensembl Gene ENSMUSG00000014725
Gene Namea disintegrin and metallopeptidase domain 28
SynonymsD430033C21Rik, C130072N01Rik, MDC-L, Dtgn1
MMRRC Submission 039088-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R0959 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location68606027-68655842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 68607938 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 761 (P761L)
Ref Sequence ENSEMBL: ENSMUSP00000153354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022642] [ENSMUST00000111072] [ENSMUST00000224039]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022642
AA Change: P761L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022642
Gene: ENSMUSG00000014725
AA Change: P761L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.5e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.7e-19 PFAM
Pfam:Reprolysin 206 402 5.6e-70 PFAM
Pfam:Reprolysin_2 226 392 1e-16 PFAM
Pfam:Reprolysin_3 230 353 1.2e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111072
AA Change: P761L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106701
Gene: ENSMUSG00000014725
AA Change: P761L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.3e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.3e-19 PFAM
Pfam:Reprolysin 206 402 5.3e-70 PFAM
Pfam:Reprolysin_2 226 392 9.9e-17 PFAM
Pfam:Reprolysin_3 230 353 1.1e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224039
AA Change: P761L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230006
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 95.8%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are typically membrane-anchored, although a form of this protein may be secreted. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate a mature protein product. This protein may bind to integrins and regulate lymphocyte migration by enhancing cell adhesion. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A G 7: 140,294,791 E394G probably damaging Het
Actl11 T C 9: 107,931,235 V919A probably damaging Het
Aplf G A 6: 87,646,083 P338L probably benign Het
Arl5b T A 2: 15,073,131 I89N probably damaging Het
Asap2 T C 12: 21,247,319 V596A probably damaging Het
Baz1b T G 5: 135,244,222 F1400C probably damaging Het
Ccdc149 A T 5: 52,385,155 L365Q probably damaging Het
Ccdc60 A G 5: 116,180,811 S149P probably damaging Het
Ces1b A G 8: 93,068,147 C275R probably damaging Het
Creb3 T C 4: 43,563,509 L163P probably damaging Het
Dhx37 T G 5: 125,423,432 N570T probably benign Het
Epc1 T C 18: 6,453,657 N223D probably damaging Het
Gbp5 C T 3: 142,503,124 H143Y possibly damaging Het
Gfod1 A T 13: 43,303,429 D23E probably benign Het
Gm12169 A T 11: 46,536,420 R187* probably null Het
Gm7361 A T 5: 26,262,053 E223D possibly damaging Het
Izumo1 A G 7: 45,624,991 K161E probably damaging Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Lrp1b T C 2: 41,268,354 N1617S possibly damaging Het
Med13l A T 5: 118,754,285 E1924D possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtg2 T G 2: 180,083,428 S145A probably benign Het
Mug2 G A 6: 122,085,495 S1442N probably benign Het
Myo1b A T 1: 51,797,087 I315N probably damaging Het
Naip2 G A 13: 100,154,878 T1184M probably benign Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nsrp1 G A 11: 77,046,459 R304* probably null Het
Olfr444 G T 6: 42,955,752 V85L probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Parp4 T C 14: 56,648,119 F1552L unknown Het
Pigw G A 11: 84,878,207 H99Y probably benign Het
Ppp6r2 G A 15: 89,274,176 M444I possibly damaging Het
Rchy1 A G 5: 91,957,617 F82L probably damaging Het
Reln A C 5: 22,227,628 F125V probably damaging Het
Riok1 G A 13: 38,057,173 E435K probably damaging Het
Rnf213 A G 11: 119,452,581 R3590G probably damaging Het
Scrib G C 15: 76,051,461 P1249A probably benign Het
Shc4 C T 2: 125,678,687 probably null Het
Slc12a2 T A 18: 57,904,378 I520N probably damaging Het
Slc26a5 A G 5: 21,816,961 I484T probably benign Het
Slc39a11 G T 11: 113,464,073 T110K probably benign Het
Snd1 T A 6: 28,884,971 S774T probably benign Het
Spata31d1c C T 13: 65,036,315 P557L probably damaging Het
Svs1 T A 6: 48,988,632 C525S possibly damaging Het
Tada1 A G 1: 166,388,629 D133G probably benign Het
Tg A T 15: 66,708,010 T1555S probably damaging Het
Thra A G 11: 98,753,629 E15G possibly damaging Het
Ttn T A 2: 76,795,096 I15128F probably damaging Het
Ube2r2 A G 4: 41,174,066 Y68C probably damaging Het
Uncx A T 5: 139,546,687 N169I probably damaging Het
Vmn2r100 A G 17: 19,523,524 Y483C possibly damaging Het
Xkr4 T C 1: 3,216,674 D431G probably damaging Het
Xylb C A 9: 119,380,025 A311E possibly damaging Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Zbtb39 C A 10: 127,743,062 H502N probably damaging Het
Zfp82 A G 7: 30,056,451 L402P probably damaging Het
Zpbp2 G A 11: 98,557,625 R256Q probably benign Het
Other mutations in Adam28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Adam28 APN 14 68622120 missense possibly damaging 0.47
IGL00654:Adam28 APN 14 68649428 missense probably benign 0.00
IGL01021:Adam28 APN 14 68642114 missense probably benign
IGL01099:Adam28 APN 14 68637329 critical splice donor site probably null
IGL01349:Adam28 APN 14 68611006 missense probably benign 0.01
IGL01744:Adam28 APN 14 68607507 missense probably benign 0.07
IGL01805:Adam28 APN 14 68642091 missense probably benign 0.09
IGL02007:Adam28 APN 14 68633219 missense possibly damaging 0.69
IGL02828:Adam28 APN 14 68646870 missense possibly damaging 0.46
IGL03180:Adam28 APN 14 68637434 missense probably damaging 1.00
IGL03355:Adam28 APN 14 68634803 splice site probably benign
IGL02980:Adam28 UTSW 14 68619806 missense probably benign 0.01
PIT4453001:Adam28 UTSW 14 68634876 missense probably benign 0.00
R0184:Adam28 UTSW 14 68637373 missense probably benign 0.33
R0321:Adam28 UTSW 14 68617751 missense probably damaging 0.97
R0329:Adam28 UTSW 14 68617739 missense probably damaging 0.96
R0494:Adam28 UTSW 14 68630792 splice site probably benign
R0605:Adam28 UTSW 14 68606600 unclassified probably benign
R0732:Adam28 UTSW 14 68637347 missense probably benign 0.00
R1319:Adam28 UTSW 14 68609129 missense probably benign 0.28
R1745:Adam28 UTSW 14 68633171 missense probably benign 0.04
R1836:Adam28 UTSW 14 68649421 missense possibly damaging 0.85
R1838:Adam28 UTSW 14 68639210 missense possibly damaging 0.53
R1839:Adam28 UTSW 14 68639210 missense possibly damaging 0.53
R1850:Adam28 UTSW 14 68639195 missense probably benign 0.01
R1912:Adam28 UTSW 14 68644331 missense probably benign 0.24
R2830:Adam28 UTSW 14 68626914 missense possibly damaging 0.65
R2889:Adam28 UTSW 14 68634845 missense possibly damaging 0.85
R3977:Adam28 UTSW 14 68610994 missense probably benign 0.20
R3978:Adam28 UTSW 14 68610994 missense probably benign 0.20
R3979:Adam28 UTSW 14 68610994 missense probably benign 0.20
R4282:Adam28 UTSW 14 68647706 missense possibly damaging 0.92
R4416:Adam28 UTSW 14 68622082 critical splice donor site probably null
R4690:Adam28 UTSW 14 68642048 missense probably benign 0.01
R4724:Adam28 UTSW 14 68626877 missense probably damaging 0.99
R4768:Adam28 UTSW 14 68634815 missense possibly damaging 0.46
R4883:Adam28 UTSW 14 68638103 missense probably damaging 0.99
R5054:Adam28 UTSW 14 68617715 missense probably damaging 1.00
R5710:Adam28 UTSW 14 68609908 missense probably damaging 0.96
R5835:Adam28 UTSW 14 68655681 missense possibly damaging 0.96
R6002:Adam28 UTSW 14 68642062 missense probably benign
R6054:Adam28 UTSW 14 68642152 missense probably benign 0.01
R6349:Adam28 UTSW 14 68633172 missense probably benign 0.29
R6449:Adam28 UTSW 14 68630667 missense probably benign 0.31
R6455:Adam28 UTSW 14 68633208 missense probably damaging 1.00
R6831:Adam28 UTSW 14 68618127 missense probably benign 0.04
R6833:Adam28 UTSW 14 68618127 missense probably benign 0.04
R7212:Adam28 UTSW 14 68637397 missense probably damaging 0.99
R7411:Adam28 UTSW 14 68626947 missense probably damaging 1.00
R7422:Adam28 UTSW 14 68626877 missense probably damaging 1.00
R7516:Adam28 UTSW 14 68630676 missense probably damaging 1.00
R7649:Adam28 UTSW 14 68634833 missense probably benign 0.12
R7765:Adam28 UTSW 14 68609106 critical splice donor site probably null
Z1177:Adam28 UTSW 14 68626784 missense not run
Predicted Primers PCR Primer
(F):5'- ACTTCAGGTACACGCGGCCTA -3'
(R):5'- GGCTCAGAACTAACTGAAAGGGTCAAAT -3'

Sequencing Primer
(F):5'- GCGGCCTATTTGCTGACTAAAAG -3'
(R):5'- CTAACTGAAAGGGTCAAATTCGTG -3'
Posted On2013-11-08