Incidental Mutation 'R0959:Adam28'
ID 81796
Institutional Source Beutler Lab
Gene Symbol Adam28
Ensembl Gene ENSMUSG00000014725
Gene Name a disintegrin and metallopeptidase domain 28
Synonyms MDC-L, D430033C21Rik, Dtgn1, C130072N01Rik
MMRRC Submission 039088-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # R0959 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 68843476-68893291 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 68845387 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 761 (P761L)
Ref Sequence ENSEMBL: ENSMUSP00000153354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022642] [ENSMUST00000111072] [ENSMUST00000224039]
AlphaFold Q9JLN6
Predicted Effect possibly damaging
Transcript: ENSMUST00000022642
AA Change: P761L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022642
Gene: ENSMUSG00000014725
AA Change: P761L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.5e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.7e-19 PFAM
Pfam:Reprolysin 206 402 5.6e-70 PFAM
Pfam:Reprolysin_2 226 392 1e-16 PFAM
Pfam:Reprolysin_3 230 353 1.2e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111072
AA Change: P761L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106701
Gene: ENSMUSG00000014725
AA Change: P761L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.3e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.3e-19 PFAM
Pfam:Reprolysin 206 402 5.3e-70 PFAM
Pfam:Reprolysin_2 226 392 9.9e-17 PFAM
Pfam:Reprolysin_3 230 353 1.1e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224039
AA Change: P761L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230006
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 95.8%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are typically membrane-anchored, although a form of this protein may be secreted. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate a mature protein product. This protein may bind to integrins and regulate lymphocyte migration by enhancing cell adhesion. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 T C 9: 107,808,434 (GRCm39) V919A probably damaging Het
Aoc1l3 T A 6: 48,965,566 (GRCm39) C525S possibly damaging Het
Aplf G A 6: 87,623,065 (GRCm39) P338L probably benign Het
Arl5b T A 2: 15,077,942 (GRCm39) I89N probably damaging Het
Asap2 T C 12: 21,297,320 (GRCm39) V596A probably damaging Het
Baz1b T G 5: 135,273,076 (GRCm39) F1400C probably damaging Het
Ccdc149 A T 5: 52,542,497 (GRCm39) L365Q probably damaging Het
Ccdc60 A G 5: 116,318,870 (GRCm39) S149P probably damaging Het
Ces1b A G 8: 93,794,775 (GRCm39) C275R probably damaging Het
Creb3 T C 4: 43,563,509 (GRCm39) L163P probably damaging Het
Dhx37 T G 5: 125,500,496 (GRCm39) N570T probably benign Het
Epc1 T C 18: 6,453,657 (GRCm39) N223D probably damaging Het
Gbp5 C T 3: 142,208,885 (GRCm39) H143Y possibly damaging Het
Gfod1 A T 13: 43,456,905 (GRCm39) D23E probably benign Het
Gm7361 A T 5: 26,467,051 (GRCm39) E223D possibly damaging Het
Izumo1 A G 7: 45,274,415 (GRCm39) K161E probably damaging Het
Kcnh2 C T 5: 24,527,670 (GRCm39) R894H probably damaging Het
Lrp1b T C 2: 41,158,366 (GRCm39) N1617S possibly damaging Het
Med13l A T 5: 118,892,350 (GRCm39) E1924D possibly damaging Het
Mroh2a GCCC GC 1: 88,159,979 (GRCm39) probably null Het
Mtg2 T G 2: 179,725,221 (GRCm39) S145A probably benign Het
Mug2 G A 6: 122,062,454 (GRCm39) S1442N probably benign Het
Myo1b A T 1: 51,836,246 (GRCm39) I315N probably damaging Het
Naip2 G A 13: 100,291,386 (GRCm39) T1184M probably benign Het
Naip2 T A 13: 100,291,419 (GRCm39) H1173L probably benign Het
Nsrp1 G A 11: 76,937,285 (GRCm39) R304* probably null Het
Or2a56 G T 6: 42,932,686 (GRCm39) V85L probably benign Het
Oxtr C T 6: 112,454,138 (GRCm39) R42Q probably benign Het
Parp4 T C 14: 56,885,576 (GRCm39) F1552L unknown Het
Pigw G A 11: 84,769,033 (GRCm39) H99Y probably benign Het
Ppp6r2 G A 15: 89,158,379 (GRCm39) M444I possibly damaging Het
Rchy1 A G 5: 92,105,476 (GRCm39) F82L probably damaging Het
Reln A C 5: 22,432,626 (GRCm39) F125V probably damaging Het
Riok1 G A 13: 38,241,149 (GRCm39) E435K probably damaging Het
Rnf213 A G 11: 119,343,407 (GRCm39) R3590G probably damaging Het
Scart2 A G 7: 139,874,704 (GRCm39) E394G probably damaging Het
Scrib G C 15: 75,923,310 (GRCm39) P1249A probably benign Het
Shc4 C T 2: 125,520,607 (GRCm39) probably null Het
Slc12a2 T A 18: 58,037,450 (GRCm39) I520N probably damaging Het
Slc26a5 A G 5: 22,021,959 (GRCm39) I484T probably benign Het
Slc39a11 G T 11: 113,354,899 (GRCm39) T110K probably benign Het
Snd1 T A 6: 28,884,970 (GRCm39) S774T probably benign Het
Spata31d1c C T 13: 65,184,129 (GRCm39) P557L probably damaging Het
Tada1 A G 1: 166,216,198 (GRCm39) D133G probably benign Het
Tg A T 15: 66,579,859 (GRCm39) T1555S probably damaging Het
Thra A G 11: 98,644,455 (GRCm39) E15G possibly damaging Het
Timd5 A T 11: 46,427,247 (GRCm39) R187* probably null Het
Ttn T A 2: 76,625,440 (GRCm39) I15128F probably damaging Het
Ube2r2 A G 4: 41,174,066 (GRCm39) Y68C probably damaging Het
Uncx A T 5: 139,532,442 (GRCm39) N169I probably damaging Het
Vmn2r100 A G 17: 19,743,786 (GRCm39) Y483C possibly damaging Het
Xkr4 T C 1: 3,286,897 (GRCm39) D431G probably damaging Het
Xylb C A 9: 119,209,091 (GRCm39) A311E possibly damaging Het
Zbtb39 C G 10: 127,578,175 (GRCm39) Q250E probably benign Het
Zbtb39 C A 10: 127,578,931 (GRCm39) H502N probably damaging Het
Zfp82 A G 7: 29,755,876 (GRCm39) L402P probably damaging Het
Zpbp2 G A 11: 98,448,451 (GRCm39) R256Q probably benign Het
Other mutations in Adam28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Adam28 APN 14 68,859,569 (GRCm39) missense possibly damaging 0.47
IGL00654:Adam28 APN 14 68,886,877 (GRCm39) missense probably benign 0.00
IGL01021:Adam28 APN 14 68,879,563 (GRCm39) missense probably benign
IGL01099:Adam28 APN 14 68,874,778 (GRCm39) critical splice donor site probably null
IGL01349:Adam28 APN 14 68,848,455 (GRCm39) missense probably benign 0.01
IGL01744:Adam28 APN 14 68,844,956 (GRCm39) missense probably benign 0.07
IGL01805:Adam28 APN 14 68,879,540 (GRCm39) missense probably benign 0.09
IGL02007:Adam28 APN 14 68,870,668 (GRCm39) missense possibly damaging 0.69
IGL02828:Adam28 APN 14 68,884,319 (GRCm39) missense possibly damaging 0.46
IGL03180:Adam28 APN 14 68,874,883 (GRCm39) missense probably damaging 1.00
IGL03355:Adam28 APN 14 68,872,252 (GRCm39) splice site probably benign
IGL02980:Adam28 UTSW 14 68,857,255 (GRCm39) missense probably benign 0.01
PIT4453001:Adam28 UTSW 14 68,872,325 (GRCm39) missense probably benign 0.00
R0184:Adam28 UTSW 14 68,874,822 (GRCm39) missense probably benign 0.33
R0321:Adam28 UTSW 14 68,855,200 (GRCm39) missense probably damaging 0.97
R0329:Adam28 UTSW 14 68,855,188 (GRCm39) missense probably damaging 0.96
R0494:Adam28 UTSW 14 68,868,241 (GRCm39) splice site probably benign
R0605:Adam28 UTSW 14 68,844,049 (GRCm39) unclassified probably benign
R0732:Adam28 UTSW 14 68,874,796 (GRCm39) missense probably benign 0.00
R1319:Adam28 UTSW 14 68,846,578 (GRCm39) missense probably benign 0.28
R1745:Adam28 UTSW 14 68,870,620 (GRCm39) missense probably benign 0.04
R1836:Adam28 UTSW 14 68,886,870 (GRCm39) missense possibly damaging 0.85
R1838:Adam28 UTSW 14 68,876,659 (GRCm39) missense possibly damaging 0.53
R1839:Adam28 UTSW 14 68,876,659 (GRCm39) missense possibly damaging 0.53
R1850:Adam28 UTSW 14 68,876,644 (GRCm39) missense probably benign 0.01
R1912:Adam28 UTSW 14 68,881,780 (GRCm39) missense probably benign 0.24
R2830:Adam28 UTSW 14 68,864,363 (GRCm39) missense possibly damaging 0.65
R2889:Adam28 UTSW 14 68,872,294 (GRCm39) missense possibly damaging 0.85
R3977:Adam28 UTSW 14 68,848,443 (GRCm39) missense probably benign 0.20
R3978:Adam28 UTSW 14 68,848,443 (GRCm39) missense probably benign 0.20
R3979:Adam28 UTSW 14 68,848,443 (GRCm39) missense probably benign 0.20
R4282:Adam28 UTSW 14 68,885,155 (GRCm39) missense possibly damaging 0.92
R4416:Adam28 UTSW 14 68,859,531 (GRCm39) critical splice donor site probably null
R4690:Adam28 UTSW 14 68,879,497 (GRCm39) missense probably benign 0.01
R4724:Adam28 UTSW 14 68,864,326 (GRCm39) missense probably damaging 0.99
R4768:Adam28 UTSW 14 68,872,264 (GRCm39) missense possibly damaging 0.46
R4883:Adam28 UTSW 14 68,875,552 (GRCm39) missense probably damaging 0.99
R5054:Adam28 UTSW 14 68,855,164 (GRCm39) missense probably damaging 1.00
R5710:Adam28 UTSW 14 68,847,357 (GRCm39) missense probably damaging 0.96
R5835:Adam28 UTSW 14 68,893,130 (GRCm39) missense possibly damaging 0.96
R6002:Adam28 UTSW 14 68,879,511 (GRCm39) missense probably benign
R6054:Adam28 UTSW 14 68,879,601 (GRCm39) missense probably benign 0.01
R6349:Adam28 UTSW 14 68,870,621 (GRCm39) missense probably benign 0.29
R6449:Adam28 UTSW 14 68,868,116 (GRCm39) missense probably benign 0.31
R6455:Adam28 UTSW 14 68,870,657 (GRCm39) missense probably damaging 1.00
R6831:Adam28 UTSW 14 68,855,576 (GRCm39) missense probably benign 0.04
R6833:Adam28 UTSW 14 68,855,576 (GRCm39) missense probably benign 0.04
R7212:Adam28 UTSW 14 68,874,846 (GRCm39) missense probably damaging 0.99
R7411:Adam28 UTSW 14 68,864,396 (GRCm39) missense probably damaging 1.00
R7422:Adam28 UTSW 14 68,864,326 (GRCm39) missense probably damaging 1.00
R7516:Adam28 UTSW 14 68,868,125 (GRCm39) missense probably damaging 1.00
R7649:Adam28 UTSW 14 68,872,282 (GRCm39) missense probably benign 0.12
R7765:Adam28 UTSW 14 68,846,555 (GRCm39) critical splice donor site probably null
R8469:Adam28 UTSW 14 68,844,029 (GRCm39) missense probably benign 0.16
R8520:Adam28 UTSW 14 68,879,532 (GRCm39) missense probably damaging 0.98
R9026:Adam28 UTSW 14 68,846,593 (GRCm39) missense probably benign 0.16
R9163:Adam28 UTSW 14 68,866,531 (GRCm39) missense probably damaging 0.98
R9264:Adam28 UTSW 14 68,844,914 (GRCm39) missense probably benign
R9304:Adam28 UTSW 14 68,874,946 (GRCm39) missense probably damaging 1.00
R9357:Adam28 UTSW 14 68,879,479 (GRCm39) missense probably benign 0.36
R9441:Adam28 UTSW 14 68,874,943 (GRCm39) missense probably damaging 0.96
Z1177:Adam28 UTSW 14 68,864,233 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCAGGTACACGCGGCCTA -3'
(R):5'- GGCTCAGAACTAACTGAAAGGGTCAAAT -3'

Sequencing Primer
(F):5'- GCGGCCTATTTGCTGACTAAAAG -3'
(R):5'- CTAACTGAAAGGGTCAAATTCGTG -3'
Posted On 2013-11-08