Incidental Mutation 'R0960:Tpd52'
ID81814
Institutional Source Beutler Lab
Gene Symbol Tpd52
Ensembl Gene ENSMUSG00000027506
Gene Nametumor protein D52
SynonymsmD52
MMRRC Submission 039089-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R0960 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location8925593-9004723 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 8943590 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063496] [ENSMUST00000063496] [ENSMUST00000091354] [ENSMUST00000091355] [ENSMUST00000094381] [ENSMUST00000094381] [ENSMUST00000120143] [ENSMUST00000121038] [ENSMUST00000124956] [ENSMUST00000134788] [ENSMUST00000145905] [ENSMUST00000155450]
Predicted Effect probably null
Transcript: ENSMUST00000063496
SMART Domains Protein: ENSMUSP00000066826
Gene: ENSMUSG00000027506

DomainStartEndE-ValueType
Pfam:TPD52 7 180 2.8e-69 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000063496
SMART Domains Protein: ENSMUSP00000066826
Gene: ENSMUSG00000027506

DomainStartEndE-ValueType
Pfam:TPD52 7 180 2.8e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091354
SMART Domains Protein: ENSMUSP00000088913
Gene: ENSMUSG00000027506

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
Pfam:TPD52 46 210 4.7e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091355
SMART Domains Protein: ENSMUSP00000088914
Gene: ENSMUSG00000027506

DomainStartEndE-ValueType
Pfam:TPD52 7 185 7.5e-70 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000094381
SMART Domains Protein: ENSMUSP00000091943
Gene: ENSMUSG00000027506

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
Pfam:TPD52 48 232 1.3e-74 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000094381
SMART Domains Protein: ENSMUSP00000091943
Gene: ENSMUSG00000027506

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
Pfam:TPD52 48 232 1.3e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120143
SMART Domains Protein: ENSMUSP00000112830
Gene: ENSMUSG00000027506

DomainStartEndE-ValueType
Pfam:TPD52 7 171 2.4e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121038
SMART Domains Protein: ENSMUSP00000113368
Gene: ENSMUSG00000027506

DomainStartEndE-ValueType
Pfam:TPD52 1 148 2.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124956
SMART Domains Protein: ENSMUSP00000119077
Gene: ENSMUSG00000027506

DomainStartEndE-ValueType
Pfam:TPD52 1 77 8.8e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129736
Predicted Effect probably benign
Transcript: ENSMUST00000134788
SMART Domains Protein: ENSMUSP00000119899
Gene: ENSMUSG00000027506

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
Pfam:TPD52 56 206 1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145905
SMART Domains Protein: ENSMUSP00000123147
Gene: ENSMUSG00000027506

DomainStartEndE-ValueType
Pfam:TPD52 4 168 8.3e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155450
SMART Domains Protein: ENSMUSP00000120317
Gene: ENSMUSG00000027506

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
transmembrane domain 36 55 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,890,428 V256A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930474N05Rik C A 14: 36,096,410 H122N probably benign Het
Aamp T C 1: 74,281,145 T341A possibly damaging Het
Adam26a A T 8: 43,568,763 H563Q probably damaging Het
Ankrd13a G A 5: 114,786,807 E118K probably benign Het
Asic5 A G 3: 82,006,540 I174V probably benign Het
Atad2b G A 12: 5,006,593 probably benign Het
Bub1b A G 2: 118,606,680 I120V probably benign Het
Casp8 T C 1: 58,829,013 probably null Het
Cdk5rap2 A G 4: 70,243,508 Y254H probably benign Het
Clasp1 T C 1: 118,552,026 I996T probably benign Het
Cntn6 A G 6: 104,774,480 I294V probably benign Het
Flnc A G 6: 29,441,512 D431G probably damaging Het
Gm4884 T A 7: 41,042,808 M67K possibly damaging Het
Hmx3 T C 7: 131,543,314 Y118H probably benign Het
Hsf2bp C T 17: 32,007,769 R204H probably damaging Het
Il12b G T 11: 44,408,488 C128F probably damaging Het
Ints6 T C 14: 62,709,566 M317V probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Kif27 T C 13: 58,323,967 E769G probably damaging Het
Kif28 G A 1: 179,695,805 Q987* probably null Het
Klhdc3 T C 17: 46,676,518 H330R possibly damaging Het
Leo1 G A 9: 75,445,240 E22K probably benign Het
Lpcat2 C T 8: 92,869,710 T125M probably benign Het
Map1a A G 2: 121,301,643 Y742C probably benign Het
Mllt6 C T 11: 97,664,946 probably benign Het
Mpp2 A G 11: 102,061,585 V354A possibly damaging Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Myo10 A G 15: 25,801,189 E1488G probably damaging Het
Neb A G 2: 52,212,983 V4461A probably benign Het
Nudcd1 G T 15: 44,427,651 probably benign Het
Olfr1129 T C 2: 87,575,935 Y284H probably benign Het
Olfr1369-ps1 A C 13: 21,116,265 D191A possibly damaging Het
Pde1a G A 2: 79,865,034 probably benign Het
Sdha A T 13: 74,323,184 probably benign Het
Selenoo T G 15: 89,096,754 I432S probably benign Het
Sh3gl2 A T 4: 85,377,480 I140F probably damaging Het
Svopl G T 6: 38,017,057 Y346* probably null Het
Tbc1d17 C T 7: 44,848,428 probably benign Het
Tlr3 A C 8: 45,397,415 I815S probably damaging Het
Tmem25 T A 9: 44,795,512 probably null Het
Tspoap1 A T 11: 87,770,595 probably benign Het
Txndc11 A T 16: 11,091,589 D364E probably benign Het
Unc5cl G T 17: 48,459,596 probably benign Het
Vmn1r13 A G 6: 57,210,011 M52V probably benign Het
Zap70 T C 1: 36,779,173 Y314H probably damaging Het
Other mutations in Tpd52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Tpd52 APN 3 8947632 splice site probably null
IGL02662:Tpd52 APN 3 8944715 splice site probably null
IGL02994:Tpd52 APN 3 8947530 missense probably benign 0.00
R0319:Tpd52 UTSW 3 8953689 missense probably benign 0.00
R1366:Tpd52 UTSW 3 8963933 missense probably damaging 0.99
R1828:Tpd52 UTSW 3 8947519 missense probably damaging 1.00
R1869:Tpd52 UTSW 3 8953802 splice site probably null
R2872:Tpd52 UTSW 3 9003406 nonsense probably null
R2872:Tpd52 UTSW 3 9003406 nonsense probably null
R4761:Tpd52 UTSW 3 8963873 missense probably damaging 1.00
R4907:Tpd52 UTSW 3 8944608 splice site probably null
R4997:Tpd52 UTSW 3 8934996 missense probably damaging 1.00
R5384:Tpd52 UTSW 3 8931195 intron probably null
R5385:Tpd52 UTSW 3 8931195 intron probably null
R5441:Tpd52 UTSW 3 9003406 nonsense probably null
R7154:Tpd52 UTSW 3 8963856 nonsense probably null
Z1177:Tpd52 UTSW 3 8931144 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAAAGGCATTTCCATAGCCCTCG -3'
(R):5'- TGTGGCTAAATAGCGCGGAACATAG -3'

Sequencing Primer
(F):5'- GGGTTCATCATACATGGTACACAAG -3'
(R):5'- CAACATGCTTATATCGGCTGTG -3'
Posted On2013-11-08