Incidental Mutation 'R0960:Kcnh2'
ID81818
Institutional Source Beutler Lab
Gene Symbol Kcnh2
Ensembl Gene ENSMUSG00000038319
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 2
Synonymsmerg1a, M-erg, Lqt2, ERG1, ether a go-go related, merg1b, LQT
MMRRC Submission 039089-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.536) question?
Stock #R0960 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location24319589-24351604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24322672 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 894 (R894H)
Ref Sequence ENSEMBL: ENSMUSP00000047705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036092] [ENSMUST00000115098]
Predicted Effect probably damaging
Transcript: ENSMUST00000036092
AA Change: R894H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047705
Gene: ENSMUSG00000038319
AA Change: R894H

DomainStartEndE-ValueType
PAS 13 87 9.54e0 SMART
PAC 93 135 1.31e-5 SMART
low complexity region 194 199 N/A INTRINSIC
Pfam:Ion_trans 409 673 7.8e-38 PFAM
Pfam:Ion_trans_2 600 667 3.2e-13 PFAM
cNMP 744 862 1.15e-24 SMART
low complexity region 885 896 N/A INTRINSIC
low complexity region 925 956 N/A INTRINSIC
low complexity region 965 982 N/A INTRINSIC
coiled coil region 1035 1069 N/A INTRINSIC
low complexity region 1082 1108 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115098
AA Change: R552H

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110750
Gene: ENSMUSG00000038319
AA Change: R552H

DomainStartEndE-ValueType
Pfam:Ion_trans 114 319 1.4e-22 PFAM
Pfam:Ion_trans_2 257 325 2.9e-14 PFAM
cNMP 402 520 1.15e-24 SMART
low complexity region 543 554 N/A INTRINSIC
low complexity region 583 614 N/A INTRINSIC
low complexity region 623 640 N/A INTRINSIC
coiled coil region 693 727 N/A INTRINSIC
low complexity region 740 766 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142197
Meta Mutation Damage Score 0.2624 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-activated potassium channel belonging to the eag family. It shares sequence similarity with the Drosophila ether-a-go-go (eag) gene. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice which maintain expression of the A isoform and lack expression of the B isoform are predisposed to episodic sinus bradycardia. Mice with mutations causing defects in both isoforms are embryonic lethal with defects in cardiac development and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,890,428 V256A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930474N05Rik C A 14: 36,096,410 H122N probably benign Het
Aamp T C 1: 74,281,145 T341A possibly damaging Het
Adam26a A T 8: 43,568,763 H563Q probably damaging Het
Ankrd13a G A 5: 114,786,807 E118K probably benign Het
Asic5 A G 3: 82,006,540 I174V probably benign Het
Atad2b G A 12: 5,006,593 probably benign Het
Bub1b A G 2: 118,606,680 I120V probably benign Het
Casp8 T C 1: 58,829,013 probably null Het
Cdk5rap2 A G 4: 70,243,508 Y254H probably benign Het
Clasp1 T C 1: 118,552,026 I996T probably benign Het
Cntn6 A G 6: 104,774,480 I294V probably benign Het
Flnc A G 6: 29,441,512 D431G probably damaging Het
Gm4884 T A 7: 41,042,808 M67K possibly damaging Het
Hmx3 T C 7: 131,543,314 Y118H probably benign Het
Hsf2bp C T 17: 32,007,769 R204H probably damaging Het
Il12b G T 11: 44,408,488 C128F probably damaging Het
Ints6 T C 14: 62,709,566 M317V probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kif27 T C 13: 58,323,967 E769G probably damaging Het
Kif28 G A 1: 179,695,805 Q987* probably null Het
Klhdc3 T C 17: 46,676,518 H330R possibly damaging Het
Leo1 G A 9: 75,445,240 E22K probably benign Het
Lpcat2 C T 8: 92,869,710 T125M probably benign Het
Map1a A G 2: 121,301,643 Y742C probably benign Het
Mllt6 C T 11: 97,664,946 probably benign Het
Mpp2 A G 11: 102,061,585 V354A possibly damaging Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Myo10 A G 15: 25,801,189 E1488G probably damaging Het
Neb A G 2: 52,212,983 V4461A probably benign Het
Nudcd1 G T 15: 44,427,651 probably benign Het
Olfr1129 T C 2: 87,575,935 Y284H probably benign Het
Olfr1369-ps1 A C 13: 21,116,265 D191A possibly damaging Het
Pde1a G A 2: 79,865,034 probably benign Het
Sdha A T 13: 74,323,184 probably benign Het
Selenoo T G 15: 89,096,754 I432S probably benign Het
Sh3gl2 A T 4: 85,377,480 I140F probably damaging Het
Svopl G T 6: 38,017,057 Y346* probably null Het
Tbc1d17 C T 7: 44,848,428 probably benign Het
Tlr3 A C 8: 45,397,415 I815S probably damaging Het
Tmem25 T A 9: 44,795,512 probably null Het
Tpd52 A T 3: 8,943,590 probably null Het
Tspoap1 A T 11: 87,770,595 probably benign Het
Txndc11 A T 16: 11,091,589 D364E probably benign Het
Unc5cl G T 17: 48,459,596 probably benign Het
Vmn1r13 A G 6: 57,210,011 M52V probably benign Het
Zap70 T C 1: 36,779,173 Y314H probably damaging Het
Other mutations in Kcnh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Kcnh2 APN 5 24324966 missense probably damaging 1.00
IGL01536:Kcnh2 APN 5 24326524 missense probably damaging 1.00
IGL02305:Kcnh2 APN 5 24322660 missense possibly damaging 0.86
IGL02379:Kcnh2 APN 5 24326638 missense probably damaging 1.00
IGL03100:Kcnh2 APN 5 24322684 missense probably damaging 1.00
IGL03326:Kcnh2 APN 5 24326413 missense probably damaging 1.00
R0077:Kcnh2 UTSW 5 24322702 missense probably benign 0.11
R0349:Kcnh2 UTSW 5 24351237 missense probably benign 0.18
R0959:Kcnh2 UTSW 5 24322672 missense probably damaging 1.00
R0963:Kcnh2 UTSW 5 24322672 missense probably damaging 1.00
R1130:Kcnh2 UTSW 5 24331825 nonsense probably null
R1147:Kcnh2 UTSW 5 24324387 missense probably damaging 1.00
R1147:Kcnh2 UTSW 5 24324387 missense probably damaging 1.00
R1201:Kcnh2 UTSW 5 24322672 missense probably damaging 1.00
R1346:Kcnh2 UTSW 5 24322660 missense possibly damaging 0.86
R1608:Kcnh2 UTSW 5 24322219 missense probably benign
R1613:Kcnh2 UTSW 5 24322762 splice site probably benign
R1797:Kcnh2 UTSW 5 24322672 missense probably damaging 1.00
R2006:Kcnh2 UTSW 5 24326570 missense probably damaging 1.00
R2312:Kcnh2 UTSW 5 24324954 critical splice donor site probably null
R2435:Kcnh2 UTSW 5 24326347 critical splice donor site probably null
R4623:Kcnh2 UTSW 5 24348442 missense probably benign 0.00
R4941:Kcnh2 UTSW 5 24331087 missense probably damaging 0.98
R5394:Kcnh2 UTSW 5 24332041 missense probably benign
R5467:Kcnh2 UTSW 5 24326767 nonsense probably null
R6127:Kcnh2 UTSW 5 24325003 missense probably damaging 1.00
R6135:Kcnh2 UTSW 5 24321793 missense probably damaging 1.00
R6280:Kcnh2 UTSW 5 24331923 missense probably benign 0.43
R6936:Kcnh2 UTSW 5 24324339 missense probably damaging 1.00
R7061:Kcnh2 UTSW 5 24331922 missense probably benign 0.01
R7136:Kcnh2 UTSW 5 24332991 missense probably benign 0.13
R7399:Kcnh2 UTSW 5 24322059 missense probably damaging 0.99
R7479:Kcnh2 UTSW 5 24325492 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAAGCCCAGCCTTTGTCCAGTG -3'
(R):5'- CCCTTCCCTGTGACTGTGGAAAAC -3'

Sequencing Primer
(F):5'- CCTTTGTCCAGTGGAAGGGAG -3'
(R):5'- GGGTAGGGAAAATTCTTCCCCAC -3'
Posted On2013-11-08