Incidental Mutation 'R0960:Ankrd13a'
ID81819
Institutional Source Beutler Lab
Gene Symbol Ankrd13a
Ensembl Gene ENSMUSG00000041870
Gene Nameankyrin repeat domain 13a
Synonyms
MMRRC Submission 039089-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R0960 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location114774677-114806200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 114786807 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 118 (E118K)
Ref Sequence ENSEMBL: ENSMUSP00000099638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102578]
Predicted Effect probably benign
Transcript: ENSMUST00000102578
AA Change: E118K

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099638
Gene: ENSMUSG00000041870
AA Change: E118K

DomainStartEndE-ValueType
ANK 40 69 1.51e-4 SMART
ANK 73 104 2.03e-1 SMART
Pfam:GPCR_chapero_1 156 468 5.5e-107 PFAM
UIM 480 500 2.98e2 SMART
UIM 517 536 2.01e1 SMART
UIM 547 566 5.33e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000137519
AA Change: E51K
SMART Domains Protein: ENSMUSP00000116994
Gene: ENSMUSG00000041870
AA Change: E51K

DomainStartEndE-ValueType
ANK 7 38 2.03e-1 SMART
Pfam:GPCR_chapero_1 90 403 8.2e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140604
Meta Mutation Damage Score 0.0972 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,890,428 V256A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930474N05Rik C A 14: 36,096,410 H122N probably benign Het
Aamp T C 1: 74,281,145 T341A possibly damaging Het
Adam26a A T 8: 43,568,763 H563Q probably damaging Het
Asic5 A G 3: 82,006,540 I174V probably benign Het
Atad2b G A 12: 5,006,593 probably benign Het
Bub1b A G 2: 118,606,680 I120V probably benign Het
Casp8 T C 1: 58,829,013 probably null Het
Cdk5rap2 A G 4: 70,243,508 Y254H probably benign Het
Clasp1 T C 1: 118,552,026 I996T probably benign Het
Cntn6 A G 6: 104,774,480 I294V probably benign Het
Flnc A G 6: 29,441,512 D431G probably damaging Het
Gm4884 T A 7: 41,042,808 M67K possibly damaging Het
Hmx3 T C 7: 131,543,314 Y118H probably benign Het
Hsf2bp C T 17: 32,007,769 R204H probably damaging Het
Il12b G T 11: 44,408,488 C128F probably damaging Het
Ints6 T C 14: 62,709,566 M317V probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Kif27 T C 13: 58,323,967 E769G probably damaging Het
Kif28 G A 1: 179,695,805 Q987* probably null Het
Klhdc3 T C 17: 46,676,518 H330R possibly damaging Het
Leo1 G A 9: 75,445,240 E22K probably benign Het
Lpcat2 C T 8: 92,869,710 T125M probably benign Het
Map1a A G 2: 121,301,643 Y742C probably benign Het
Mllt6 C T 11: 97,664,946 probably benign Het
Mpp2 A G 11: 102,061,585 V354A possibly damaging Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Myo10 A G 15: 25,801,189 E1488G probably damaging Het
Neb A G 2: 52,212,983 V4461A probably benign Het
Nudcd1 G T 15: 44,427,651 probably benign Het
Olfr1129 T C 2: 87,575,935 Y284H probably benign Het
Olfr1369-ps1 A C 13: 21,116,265 D191A possibly damaging Het
Pde1a G A 2: 79,865,034 probably benign Het
Sdha A T 13: 74,323,184 probably benign Het
Selenoo T G 15: 89,096,754 I432S probably benign Het
Sh3gl2 A T 4: 85,377,480 I140F probably damaging Het
Svopl G T 6: 38,017,057 Y346* probably null Het
Tbc1d17 C T 7: 44,848,428 probably benign Het
Tlr3 A C 8: 45,397,415 I815S probably damaging Het
Tmem25 T A 9: 44,795,512 probably null Het
Tpd52 A T 3: 8,943,590 probably null Het
Tspoap1 A T 11: 87,770,595 probably benign Het
Txndc11 A T 16: 11,091,589 D364E probably benign Het
Unc5cl G T 17: 48,459,596 probably benign Het
Vmn1r13 A G 6: 57,210,011 M52V probably benign Het
Zap70 T C 1: 36,779,173 Y314H probably damaging Het
Other mutations in Ankrd13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Ankrd13a APN 5 114801802 missense probably damaging 0.99
IGL01303:Ankrd13a APN 5 114786002 missense possibly damaging 0.94
IGL01392:Ankrd13a APN 5 114797853 missense probably benign
IGL01480:Ankrd13a APN 5 114800818 splice site probably benign
IGL01652:Ankrd13a APN 5 114791336 missense probably damaging 1.00
IGL02213:Ankrd13a APN 5 114785968 missense probably damaging 1.00
IGL02512:Ankrd13a APN 5 114786766 missense probably benign 0.16
IGL03268:Ankrd13a APN 5 114792235 missense probably damaging 1.00
R0019:Ankrd13a UTSW 5 114786081 splice site probably benign
R0019:Ankrd13a UTSW 5 114786081 splice site probably benign
R0465:Ankrd13a UTSW 5 114804234 missense probably damaging 0.98
R1222:Ankrd13a UTSW 5 114800763 nonsense probably null
R1538:Ankrd13a UTSW 5 114804234 missense possibly damaging 0.87
R1667:Ankrd13a UTSW 5 114786733 missense possibly damaging 0.89
R1771:Ankrd13a UTSW 5 114803588 missense probably benign 0.08
R2015:Ankrd13a UTSW 5 114792109 missense probably damaging 1.00
R4547:Ankrd13a UTSW 5 114775296 missense probably benign 0.01
R4569:Ankrd13a UTSW 5 114789312 missense probably damaging 1.00
R5401:Ankrd13a UTSW 5 114792173 missense probably damaging 1.00
R5635:Ankrd13a UTSW 5 114801717 missense possibly damaging 0.95
R6238:Ankrd13a UTSW 5 114786726 missense probably benign 0.00
R6562:Ankrd13a UTSW 5 114804392 unclassified probably benign
R6623:Ankrd13a UTSW 5 114786757 missense probably benign 0.28
R6772:Ankrd13a UTSW 5 114801743 missense probably benign 0.00
R7146:Ankrd13a UTSW 5 114775232 missense probably damaging 1.00
R7440:Ankrd13a UTSW 5 114803575 missense possibly damaging 0.65
R7567:Ankrd13a UTSW 5 114789484 intron probably null
R7849:Ankrd13a UTSW 5 114791282 missense possibly damaging 0.89
R7932:Ankrd13a UTSW 5 114791282 missense possibly damaging 0.89
R8006:Ankrd13a UTSW 5 114804423 makesense probably null
Predicted Primers PCR Primer
(F):5'- GGATGCTTTGTGATTCTGTCCCACC -3'
(R):5'- GGCAAATTGTGTTGGACATGCACTG -3'

Sequencing Primer
(F):5'- GATTCTGTCCCACCCTTTGG -3'
(R):5'- GACATAACTTGTAGGAGGCCCC -3'
Posted On2013-11-08