Incidental Mutation 'R0960:Gm4884'
ID81825
Institutional Source Beutler Lab
Gene Symbol Gm4884
Ensembl Gene ENSMUSG00000048312
Gene Namepredicted gene 4884
Synonyms
MMRRC Submission 039089-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R0960 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location41032719-41045302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41042808 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 67 (M67K)
Ref Sequence ENSEMBL: ENSMUSP00000133059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164422]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164422
AA Change: M67K

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133059
Gene: ENSMUSG00000048312
AA Change: M67K

DomainStartEndE-ValueType
Pfam:DUF4629 243 387 8e-62 PFAM
low complexity region 509 533 N/A INTRINSIC
internal_repeat_1 554 584 1.89e-11 PROSPERO
internal_repeat_1 583 613 1.89e-11 PROSPERO
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,890,428 V256A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930474N05Rik C A 14: 36,096,410 H122N probably benign Het
Aamp T C 1: 74,281,145 T341A possibly damaging Het
Adam26a A T 8: 43,568,763 H563Q probably damaging Het
Ankrd13a G A 5: 114,786,807 E118K probably benign Het
Asic5 A G 3: 82,006,540 I174V probably benign Het
Atad2b G A 12: 5,006,593 probably benign Het
Bub1b A G 2: 118,606,680 I120V probably benign Het
Casp8 T C 1: 58,829,013 probably null Het
Cdk5rap2 A G 4: 70,243,508 Y254H probably benign Het
Clasp1 T C 1: 118,552,026 I996T probably benign Het
Cntn6 A G 6: 104,774,480 I294V probably benign Het
Flnc A G 6: 29,441,512 D431G probably damaging Het
Hmx3 T C 7: 131,543,314 Y118H probably benign Het
Hsf2bp C T 17: 32,007,769 R204H probably damaging Het
Il12b G T 11: 44,408,488 C128F probably damaging Het
Ints6 T C 14: 62,709,566 M317V probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Kif27 T C 13: 58,323,967 E769G probably damaging Het
Kif28 G A 1: 179,695,805 Q987* probably null Het
Klhdc3 T C 17: 46,676,518 H330R possibly damaging Het
Leo1 G A 9: 75,445,240 E22K probably benign Het
Lpcat2 C T 8: 92,869,710 T125M probably benign Het
Map1a A G 2: 121,301,643 Y742C probably benign Het
Mllt6 C T 11: 97,664,946 probably benign Het
Mpp2 A G 11: 102,061,585 V354A possibly damaging Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Myo10 A G 15: 25,801,189 E1488G probably damaging Het
Neb A G 2: 52,212,983 V4461A probably benign Het
Nudcd1 G T 15: 44,427,651 probably benign Het
Olfr1129 T C 2: 87,575,935 Y284H probably benign Het
Olfr1369-ps1 A C 13: 21,116,265 D191A possibly damaging Het
Pde1a G A 2: 79,865,034 probably benign Het
Sdha A T 13: 74,323,184 probably benign Het
Selenoo T G 15: 89,096,754 I432S probably benign Het
Sh3gl2 A T 4: 85,377,480 I140F probably damaging Het
Svopl G T 6: 38,017,057 Y346* probably null Het
Tbc1d17 C T 7: 44,848,428 probably benign Het
Tlr3 A C 8: 45,397,415 I815S probably damaging Het
Tmem25 T A 9: 44,795,512 probably null Het
Tpd52 A T 3: 8,943,590 probably null Het
Tspoap1 A T 11: 87,770,595 probably benign Het
Txndc11 A T 16: 11,091,589 D364E probably benign Het
Unc5cl G T 17: 48,459,596 probably benign Het
Vmn1r13 A G 6: 57,210,011 M52V probably benign Het
Zap70 T C 1: 36,779,173 Y314H probably damaging Het
Other mutations in Gm4884
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Gm4884 APN 7 41044385 missense probably benign 0.22
IGL00980:Gm4884 APN 7 41043726 missense probably damaging 1.00
IGL02230:Gm4884 APN 7 41043405 missense probably damaging 1.00
IGL03271:Gm4884 APN 7 41043275 missense probably benign 0.33
IGL03274:Gm4884 APN 7 41044545 missense probably damaging 1.00
R0013:Gm4884 UTSW 7 41044292 missense probably damaging 1.00
R0139:Gm4884 UTSW 7 41042963 missense probably benign 0.00
R0179:Gm4884 UTSW 7 41043828 missense probably benign 0.26
R1167:Gm4884 UTSW 7 41043912 missense possibly damaging 0.92
R1311:Gm4884 UTSW 7 41043115 missense possibly damaging 0.73
R1466:Gm4884 UTSW 7 41043128 missense probably damaging 0.96
R1466:Gm4884 UTSW 7 41043128 missense probably damaging 0.96
R1581:Gm4884 UTSW 7 41043831 missense probably benign 0.09
R1622:Gm4884 UTSW 7 41042841 missense probably damaging 0.99
R1891:Gm4884 UTSW 7 41043115 missense possibly damaging 0.73
R1952:Gm4884 UTSW 7 41044247 missense probably benign 0.02
R2198:Gm4884 UTSW 7 41040805 missense probably benign
R2209:Gm4884 UTSW 7 41043321 missense possibly damaging 0.47
R2210:Gm4884 UTSW 7 41043546 missense possibly damaging 0.72
R2219:Gm4884 UTSW 7 41043486 missense possibly damaging 0.75
R3688:Gm4884 UTSW 7 41043486 missense possibly damaging 0.75
R4437:Gm4884 UTSW 7 41043090 missense probably damaging 0.97
R4472:Gm4884 UTSW 7 41043263 missense probably benign 0.35
R5137:Gm4884 UTSW 7 41042894 missense probably damaging 0.99
R5700:Gm4884 UTSW 7 41043219 missense probably benign 0.22
R5875:Gm4884 UTSW 7 41042936 missense possibly damaging 0.75
R6479:Gm4884 UTSW 7 41040787 missense probably damaging 0.99
R6659:Gm4884 UTSW 7 41044622 missense probably damaging 1.00
R7180:Gm4884 UTSW 7 41044209 missense possibly damaging 0.89
R7844:Gm4884 UTSW 7 41040698 missense probably benign 0.11
R7927:Gm4884 UTSW 7 41040698 missense probably benign 0.11
RF013:Gm4884 UTSW 7 41040809 missense probably damaging 1.00
Z1088:Gm4884 UTSW 7 41042876 missense possibly damaging 0.71
Z1177:Gm4884 UTSW 7 41032737 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGAAACGAAGCAGTAACCATCGGTC -3'
(R):5'- GCAAGTCAGGGTGTTCCAAAGTCAG -3'

Sequencing Primer
(F):5'- AGTAACCATCGGTCTGCCC -3'
(R):5'- TTCCAAAGTCAGGACTGGTG -3'
Posted On2013-11-08