Incidental Mutation 'R0960:Atad2b'
ID 81837
Institutional Source Beutler Lab
Gene Symbol Atad2b
Ensembl Gene ENSMUSG00000052812
Gene Name ATPase family, AAA domain containing 2B
Synonyms D530031C13Rik, 1110014E10Rik
MMRRC Submission 039089-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0960 (G1)
Quality Score 169
Status Validated
Chromosome 12
Chromosomal Location 4917353-5047394 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 5006593 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045664] [ENSMUST00000218859]
AlphaFold E9Q166
Predicted Effect probably benign
Transcript: ENSMUST00000045664
SMART Domains Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 252 278 N/A INTRINSIC
AAA 432 573 4.56e-20 SMART
SCOP:d1e32a2 771 912 3e-4 SMART
BROMO 958 1070 4.24e-20 SMART
low complexity region 1135 1144 N/A INTRINSIC
low complexity region 1230 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218859
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,890,428 V256A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930474N05Rik C A 14: 36,096,410 H122N probably benign Het
Aamp T C 1: 74,281,145 T341A possibly damaging Het
Adam26a A T 8: 43,568,763 H563Q probably damaging Het
Ankrd13a G A 5: 114,786,807 E118K probably benign Het
Asic5 A G 3: 82,006,540 I174V probably benign Het
Bub1b A G 2: 118,606,680 I120V probably benign Het
Casp8 T C 1: 58,829,013 probably null Het
Cdk5rap2 A G 4: 70,243,508 Y254H probably benign Het
Clasp1 T C 1: 118,552,026 I996T probably benign Het
Cntn6 A G 6: 104,774,480 I294V probably benign Het
Flnc A G 6: 29,441,512 D431G probably damaging Het
Gm4884 T A 7: 41,042,808 M67K possibly damaging Het
Hmx3 T C 7: 131,543,314 Y118H probably benign Het
Hsf2bp C T 17: 32,007,769 R204H probably damaging Het
Il12b G T 11: 44,408,488 C128F probably damaging Het
Ints6 T C 14: 62,709,566 M317V probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Kif27 T C 13: 58,323,967 E769G probably damaging Het
Kif28 G A 1: 179,695,805 Q987* probably null Het
Klhdc3 T C 17: 46,676,518 H330R possibly damaging Het
Leo1 G A 9: 75,445,240 E22K probably benign Het
Lpcat2 C T 8: 92,869,710 T125M probably benign Het
Map1a A G 2: 121,301,643 Y742C probably benign Het
Mllt6 C T 11: 97,664,946 probably benign Het
Mpp2 A G 11: 102,061,585 V354A possibly damaging Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Myo10 A G 15: 25,801,189 E1488G probably damaging Het
Neb A G 2: 52,212,983 V4461A probably benign Het
Nudcd1 G T 15: 44,427,651 probably benign Het
Olfr1129 T C 2: 87,575,935 Y284H probably benign Het
Olfr1369-ps1 A C 13: 21,116,265 D191A possibly damaging Het
Pde1a G A 2: 79,865,034 probably benign Het
Sdha A T 13: 74,323,184 probably benign Het
Selenoo T G 15: 89,096,754 I432S probably benign Het
Sh3gl2 A T 4: 85,377,480 I140F probably damaging Het
Svopl G T 6: 38,017,057 Y346* probably null Het
Tbc1d17 C T 7: 44,848,428 probably benign Het
Tlr3 A C 8: 45,397,415 I815S probably damaging Het
Tmem25 T A 9: 44,795,512 probably null Het
Tpd52 A T 3: 8,943,590 probably null Het
Tspoap1 A T 11: 87,770,595 probably benign Het
Txndc11 A T 16: 11,091,589 D364E probably benign Het
Unc5cl G T 17: 48,459,596 probably benign Het
Vmn1r13 A G 6: 57,210,011 M52V probably benign Het
Zap70 T C 1: 36,779,173 Y314H probably damaging Het
Other mutations in Atad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Atad2b APN 12 5024593 missense probably damaging 1.00
IGL00917:Atad2b APN 12 4965837 unclassified probably benign
IGL01011:Atad2b APN 12 4965984 missense probably benign 0.01
IGL01092:Atad2b APN 12 5017987 missense probably damaging 0.98
IGL01604:Atad2b APN 12 4965837 unclassified probably benign
IGL01924:Atad2b APN 12 5034093 missense probably damaging 1.00
IGL02197:Atad2b APN 12 5018056 missense possibly damaging 0.84
IGL02397:Atad2b APN 12 4974046 missense probably damaging 1.00
IGL02404:Atad2b APN 12 4941972 missense probably benign 0.08
IGL02517:Atad2b APN 12 5018037 missense probably benign 0.07
IGL02726:Atad2b APN 12 4974003 nonsense probably null
IGL02896:Atad2b APN 12 4958151 missense probably damaging 1.00
IGL03227:Atad2b APN 12 5006715 missense probably damaging 1.00
IGL03265:Atad2b APN 12 5024628 missense probably benign 0.24
Plyers UTSW 12 4973970 missense probably damaging 1.00
Smidge UTSW 12 4990949 missense probably damaging 1.00
Tensor UTSW 12 4957558 missense probably damaging 1.00
Traction UTSW 12 5027182 critical splice donor site probably null
Vice UTSW 12 5018002 missense probably damaging 1.00
K3955:Atad2b UTSW 12 4954536 splice site probably benign
P0038:Atad2b UTSW 12 4954536 splice site probably benign
PIT4418001:Atad2b UTSW 12 5024587 missense probably benign 0.07
PIT4431001:Atad2b UTSW 12 5031795 missense possibly damaging 0.77
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0124:Atad2b UTSW 12 4952676 missense probably benign 0.23
R0462:Atad2b UTSW 12 4941973 missense possibly damaging 0.79
R0483:Atad2b UTSW 12 4945035 splice site probably benign
R0617:Atad2b UTSW 12 4937401 missense probably benign 0.43
R0894:Atad2b UTSW 12 4965915 missense probably damaging 1.00
R0942:Atad2b UTSW 12 5024591 missense probably damaging 1.00
R0973:Atad2b UTSW 12 5031784 missense probably benign 0.00
R1306:Atad2b UTSW 12 4974239 missense probably benign 0.08
R1530:Atad2b UTSW 12 4942018 nonsense probably null
R1678:Atad2b UTSW 12 4965899 missense possibly damaging 0.91
R1689:Atad2b UTSW 12 5034575 nonsense probably null
R1826:Atad2b UTSW 12 4974094 missense probably benign 0.00
R1996:Atad2b UTSW 12 4990883 missense probably benign 0.01
R2233:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2235:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2943:Atad2b UTSW 12 4942067 missense probably damaging 0.98
R3161:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3508:Atad2b UTSW 12 4950595 critical splice donor site probably null
R4239:Atad2b UTSW 12 4985710 missense probably benign 0.05
R4401:Atad2b UTSW 12 4940145 missense probably damaging 0.99
R4558:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4559:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4573:Atad2b UTSW 12 4954663 splice site probably null
R4639:Atad2b UTSW 12 5018053 missense probably damaging 1.00
R4847:Atad2b UTSW 12 4944901 splice site probably null
R4850:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4851:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4979:Atad2b UTSW 12 5034513 missense probably damaging 1.00
R5024:Atad2b UTSW 12 4937534 missense probably benign 0.45
R5305:Atad2b UTSW 12 4965855 missense probably damaging 1.00
R5405:Atad2b UTSW 12 4940098 missense possibly damaging 0.87
R5627:Atad2b UTSW 12 4917911 missense probably benign 0.01
R5754:Atad2b UTSW 12 5010351 missense probably benign 0.01
R6163:Atad2b UTSW 12 4954593 missense probably benign 0.00
R6371:Atad2b UTSW 12 4973970 missense probably damaging 1.00
R6374:Atad2b UTSW 12 5018002 missense probably damaging 1.00
R6399:Atad2b UTSW 12 4957558 missense probably damaging 1.00
R6433:Atad2b UTSW 12 4952642 missense possibly damaging 0.89
R6546:Atad2b UTSW 12 4990949 missense probably damaging 1.00
R6617:Atad2b UTSW 12 5024668 missense probably benign 0.00
R7199:Atad2b UTSW 12 5017992 missense probably damaging 1.00
R7267:Atad2b UTSW 12 5027105 nonsense probably null
R7405:Atad2b UTSW 12 4943232 missense probably benign 0.08
R7460:Atad2b UTSW 12 4952660 missense probably benign 0.28
R7568:Atad2b UTSW 12 5010390 critical splice donor site probably null
R7593:Atad2b UTSW 12 5031726 missense probably benign 0.16
R7648:Atad2b UTSW 12 5027182 critical splice donor site probably null
R8253:Atad2b UTSW 12 4974159 missense possibly damaging 0.54
R8253:Atad2b UTSW 12 4974160 missense probably benign 0.02
R8708:Atad2b UTSW 12 4961253 missense probably damaging 1.00
R8894:Atad2b UTSW 12 5014001 critical splice donor site probably null
R8948:Atad2b UTSW 12 4991012 missense possibly damaging 0.87
R8976:Atad2b UTSW 12 4917923 critical splice donor site probably null
R9052:Atad2b UTSW 12 4965982 missense probably damaging 1.00
R9057:Atad2b UTSW 12 5018102 nonsense probably null
R9134:Atad2b UTSW 12 5010351 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCTTGTTTGTACATGGTAAAGGCCAA -3'
(R):5'- TCAGGCAGTTCACTGTACATGGTTTC -3'

Sequencing Primer
(F):5'- TGTACATGGTAAAGGCCAATTTTC -3'
(R):5'- ACTGTACATGGTTTCAGAGGTAGAC -3'
Posted On 2013-11-08