Incidental Mutation 'R0960:Olfr1369-ps1'
ID 81838
Institutional Source Beutler Lab
Gene Symbol Olfr1369-ps1
Ensembl Gene ENSMUSG00000060404
Gene Name olfactory receptor 1369, pseudogene 1
Synonyms GA_x6K02T2QHY8-12126170-12125935, MOR256-31
MMRRC Submission 039089-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.397) question?
Stock # R0960 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 21111483-21119095 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 21116265 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 191 (D191A)
Ref Sequence ENSEMBL: ENSMUSP00000151041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079050] [ENSMUST00000213326] [ENSMUST00000213922] [ENSMUST00000215207] [ENSMUST00000215941]
AlphaFold A0A140T8K7
Predicted Effect possibly damaging
Transcript: ENSMUST00000079050
AA Change: D191A

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078059
Gene: ENSMUSG00000060404
AA Change: D191A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.2e-47 PFAM
Pfam:7tm_1 41 290 1.1e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213326
AA Change: D191A

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213922
AA Change: D191A

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215207
AA Change: D191A

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215941
AA Change: D191A

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,890,428 V256A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930474N05Rik C A 14: 36,096,410 H122N probably benign Het
Aamp T C 1: 74,281,145 T341A possibly damaging Het
Adam26a A T 8: 43,568,763 H563Q probably damaging Het
Ankrd13a G A 5: 114,786,807 E118K probably benign Het
Asic5 A G 3: 82,006,540 I174V probably benign Het
Atad2b G A 12: 5,006,593 probably benign Het
Bub1b A G 2: 118,606,680 I120V probably benign Het
Casp8 T C 1: 58,829,013 probably null Het
Cdk5rap2 A G 4: 70,243,508 Y254H probably benign Het
Clasp1 T C 1: 118,552,026 I996T probably benign Het
Cntn6 A G 6: 104,774,480 I294V probably benign Het
Flnc A G 6: 29,441,512 D431G probably damaging Het
Gm4884 T A 7: 41,042,808 M67K possibly damaging Het
Hmx3 T C 7: 131,543,314 Y118H probably benign Het
Hsf2bp C T 17: 32,007,769 R204H probably damaging Het
Il12b G T 11: 44,408,488 C128F probably damaging Het
Ints6 T C 14: 62,709,566 M317V probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Kif27 T C 13: 58,323,967 E769G probably damaging Het
Kif28 G A 1: 179,695,805 Q987* probably null Het
Klhdc3 T C 17: 46,676,518 H330R possibly damaging Het
Leo1 G A 9: 75,445,240 E22K probably benign Het
Lpcat2 C T 8: 92,869,710 T125M probably benign Het
Map1a A G 2: 121,301,643 Y742C probably benign Het
Mllt6 C T 11: 97,664,946 probably benign Het
Mpp2 A G 11: 102,061,585 V354A possibly damaging Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Myo10 A G 15: 25,801,189 E1488G probably damaging Het
Neb A G 2: 52,212,983 V4461A probably benign Het
Nudcd1 G T 15: 44,427,651 probably benign Het
Olfr1129 T C 2: 87,575,935 Y284H probably benign Het
Pde1a G A 2: 79,865,034 probably benign Het
Sdha A T 13: 74,323,184 probably benign Het
Selenoo T G 15: 89,096,754 I432S probably benign Het
Sh3gl2 A T 4: 85,377,480 I140F probably damaging Het
Svopl G T 6: 38,017,057 Y346* probably null Het
Tbc1d17 C T 7: 44,848,428 probably benign Het
Tlr3 A C 8: 45,397,415 I815S probably damaging Het
Tmem25 T A 9: 44,795,512 probably null Het
Tpd52 A T 3: 8,943,590 probably null Het
Tspoap1 A T 11: 87,770,595 probably benign Het
Txndc11 A T 16: 11,091,589 D364E probably benign Het
Unc5cl G T 17: 48,459,596 probably benign Het
Vmn1r13 A G 6: 57,210,011 M52V probably benign Het
Zap70 T C 1: 36,779,173 Y314H probably damaging Het
Other mutations in Olfr1369-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01689:Olfr1369-ps1 APN 13 21116073 missense probably damaging 0.97
R0631:Olfr1369-ps1 UTSW 13 21115908 missense probably damaging 1.00
R1499:Olfr1369-ps1 UTSW 13 21116133 missense probably benign 0.32
R1549:Olfr1369-ps1 UTSW 13 21116118 missense probably benign 0.01
R1698:Olfr1369-ps1 UTSW 13 21116565 missense probably benign 0.11
R1711:Olfr1369-ps1 UTSW 13 21116306 missense probably benign 0.01
R2404:Olfr1369-ps1 UTSW 13 21115842 missense probably damaging 1.00
R2471:Olfr1369-ps1 UTSW 13 21116429 missense probably damaging 1.00
R3844:Olfr1369-ps1 UTSW 13 21116063 missense possibly damaging 0.91
R3977:Olfr1369-ps1 UTSW 13 21115861 missense probably benign 0.03
R3979:Olfr1369-ps1 UTSW 13 21115861 missense probably benign 0.03
R4804:Olfr1369-ps1 UTSW 13 21116005 nonsense probably null
R4914:Olfr1369-ps1 UTSW 13 21116397 missense probably benign 0.12
R5210:Olfr1369-ps1 UTSW 13 21116052 missense probably damaging 0.99
R5359:Olfr1369-ps1 UTSW 13 21116267 missense probably damaging 1.00
R5700:Olfr1369-ps1 UTSW 13 21116001 missense probably damaging 1.00
R6218:Olfr1369-ps1 UTSW 13 21116231 missense probably damaging 1.00
R6767:Olfr1369-ps1 UTSW 13 21116057 missense probably benign 0.02
R7396:Olfr1369-ps1 UTSW 13 21116307 missense probably benign 0.02
R7476:Olfr1369-ps1 UTSW 13 21116021 missense probably benign 0.04
R7612:Olfr1369-ps1 UTSW 13 21116047 missense probably damaging 0.99
R8257:Olfr1369-ps1 UTSW 13 21116373 missense probably benign 0.11
R9388:Olfr1369-ps1 UTSW 13 21116604 missense probably damaging 0.96
V8831:Olfr1369-ps1 UTSW 13 21116003 missense possibly damaging 0.93
Z1176:Olfr1369-ps1 UTSW 13 21116601 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTGAGTGTCTGCTCCTAGCTGTC -3'
(R):5'- AGGAACTTGCCCTGGTCCTTAGAG -3'

Sequencing Primer
(F):5'- CACAGCTATTTGTAAGCCCTTG -3'
(R):5'- GGTCCTTAGAGGCCCTGTTAC -3'
Posted On 2013-11-08